Construct: shRNA TRCN0000072181

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_437s1c1
DNA Barcode:
ACAACAGCCACAACGTCTATA

Original Target:

Taxon:
Control
Gene:
GFP (GFP)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 437 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072181)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL GFP GFP clonetechGfp clonetechGfp.1 100% CDS 437 13.200 N/A
2 CONTROL BFP BFP Hahn Lab BFP BFP.1 95% CDS 437 N/A N/A
3 CONTROL eGFP eGFP Hahn Lab eGFP eGFP.1 100% CDS 437 13.200 N/A
4 human 5794 PTPRH protein tyrosine phosphatas... NM_001161440.2 85% CDS 308 N/A N/A
5 human 5794 PTPRH protein tyrosine phosphatas... NM_002842.4 85% CDS 308 N/A N/A
6 human 5794 PTPRH protein tyrosine phosphatas... XM_011527183.1 85% CDS 329 N/A N/A
7 human 5794 PTPRH protein tyrosine phosphatas... XM_011527188.1 85% 5UTR 278 N/A N/A
8 human 5794 PTPRH protein tyrosine phosphatas... XM_011527190.1 85% CDS 329 N/A N/A
9 human 5794 PTPRH protein tyrosine phosphatas... XM_017027056.1 85% CDS 316 N/A N/A
10 human 5794 PTPRH protein tyrosine phosphatas... XM_017027057.1 85% CDS 316 N/A N/A
11 human 5794 PTPRH protein tyrosine phosphatas... XM_017027058.1 85% CDS 349 N/A N/A
12 human 5794 PTPRH protein tyrosine phosphatas... XM_017027059.1 85% CDS 316 N/A N/A
13 human 5794 PTPRH protein tyrosine phosphatas... XM_017027060.1 85% CDS 316 N/A N/A
14 human 5794 PTPRH protein tyrosine phosphatas... XM_017027061.1 85% CDS 316 N/A N/A
15 human 5794 PTPRH protein tyrosine phosphatas... XM_017027062.1 85% 5UTR 224 N/A N/A
16 human 5794 PTPRH protein tyrosine phosphatas... XM_017027063.1 85% 5UTR 217 N/A N/A
17 human 5794 PTPRH protein tyrosine phosphatas... XM_017027064.1 85% CDS 316 N/A N/A
18 human 5794 PTPRH protein tyrosine phosphatas... XR_001753730.1 85% 3UTR 316 N/A N/A
19 human 5794 PTPRH protein tyrosine phosphatas... XR_001753731.1 85% 3UTR 316 N/A N/A
20 human 10914 PAPOLA poly(A) polymerase alpha NM_001252007.1 85% 3UTR 1742 N/A N/A
21 human 219285 SAMD9L sterile alpha motif domain ... NM_001303496.1 85% 3UTR 6818 N/A N/A
22 human 219285 SAMD9L sterile alpha motif domain ... NM_001303497.1 85% 3UTR 6647 N/A N/A
23 human 219285 SAMD9L sterile alpha motif domain ... NM_001303498.1 85% 3UTR 6383 N/A N/A
24 human 219285 SAMD9L sterile alpha motif domain ... NM_001303500.1 85% 3UTR 6251 N/A N/A
25 human 219285 SAMD9L sterile alpha motif domain ... NM_152703.3 85% 3UTR 7023 N/A N/A
26 human 219285 SAMD9L sterile alpha motif domain ... XM_005250193.3 85% 3UTR 6455 N/A N/A
27 human 219285 SAMD9L sterile alpha motif domain ... XM_006715890.1 85% 3UTR 5824 N/A N/A
28 human 219285 SAMD9L sterile alpha motif domain ... XM_011515903.2 85% 3UTR 6708 N/A N/A
29 human 219285 SAMD9L sterile alpha motif domain ... XM_017011822.1 85% 3UTR 6772 N/A N/A
30 human 219285 SAMD9L sterile alpha motif domain ... XM_017011823.1 85% 3UTR 6528 N/A N/A
31 mouse 30046 Zfp292 zinc finger protein 292 NM_013889.2 85% CDS 4289 N/A N/A
32 mouse 30046 Zfp292 zinc finger protein 292 XM_006537977.2 85% CDS 906 N/A N/A
33 mouse 30046 Zfp292 zinc finger protein 292 XM_006537978.3 85% 3UTR 6176 N/A N/A
34 mouse 239420 Csmd3 CUB and Sushi multiple doma... NM_001081391.2 89% 5UTR 25 N/A N/A
35 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_006520909.3 89% 5UTR 218 N/A N/A
36 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_006520910.3 89% 5UTR 218 N/A N/A
37 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_011245610.2 89% 5UTR 219 N/A N/A
38 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_011245611.2 89% 5UTR 218 N/A N/A
39 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_011245613.2 89% 5UTR 234 N/A N/A
40 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_011245614.2 89% 5UTR 244 N/A N/A
41 mouse 239420 Csmd3 CUB and Sushi multiple doma... XR_001781523.1 89% 3UTR 233 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACAACAGCCACAACGTCTATA
Hairpin Sequence:
5'-CCGG-ACAACAGCCACAACGTCTATA-CTCGAG-TATAGACGTTGTGGCTGTTGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACAACAGCCACAACGTCTATACTCGAGTATAGACGTTGTGGCTGTTGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACAACAGCCACAACGTCTATACTCGAGTATAGACGTTGTGGCTGTTGT-3'

Other clones with same target sequence:

  1. TRCN0000231753
  2. TRCN0000559393
  3. TRCN0000559394
  4. TRCN0000559395
  5. TRCN0000559396
  6. TRCN0000559397
  7. TRCN0000559399
  8. TRCN0000559401
  9. TRCN0000559403
  10. TRCN0000559407
  11. TRCN0000559408