Construct: shRNA TRCN0000072186

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_587s1c1
DNA Barcode:
TGCCCGACAACCACTACCTGA

Original Target:

Taxon:
Control
Gene:
GFP (GFP)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 587 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072186)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL GFP GFP clonetechGfp clonetechGfp.1 100% CDS 587 0.880 N/A
2 CONTROL BFP BFP Hahn Lab BFP BFP.1 95% CDS 587 N/A N/A
3 CONTROL eGFP eGFP Hahn Lab eGFP eGFP.1 100% CDS 587 0.880 N/A
4 human 4035 LRP1 LDL receptor related protein 1 NM_002332.2 89% CDS 4110 N/A N/A
5 human 4035 LRP1 LDL receptor related protein 1 XM_017019303.1 89% CDS 4259 N/A N/A
6 human 388165 UBE2Q2P1 ubiquitin conjugating enzym... NR_003661.2 85% 3UTR 1368 N/A N/A
7 human 105371480 LOC105371480 uncharacterized LOC105371480 XR_001734377.1 89% 3UTR 2101 N/A N/A
8 human 105371480 LOC105371480 uncharacterized LOC105371480 XR_001753073.1 89% 3UTR 2100 N/A N/A
9 human 105371480 LOC105371480 uncharacterized LOC105371480 XR_001756366.1 89% 3UTR 2100 N/A N/A
10 human 105375183 LOC105375183 uncharacterized LOC105375183 XR_001745113.1 85% 3UTR 1079 N/A N/A
11 human 105375183 LOC105375183 uncharacterized LOC105375183 XR_001745114.1 85% 3UTR 1079 N/A N/A
12 human 105375183 LOC105375183 uncharacterized LOC105375183 XR_001758414.1 85% 3UTR 1079 N/A N/A
13 human 105375183 LOC105375183 uncharacterized LOC105375183 XR_001758415.1 85% 3UTR 1079 N/A N/A
14 mouse 102631675 Gm29954 predicted gene, 29954 XR_387479.2 85% 3UTR 906 N/A N/A
15 mouse 102631675 Gm29954 predicted gene, 29954 XR_878609.1 85% 3UTR 1054 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TGCCCGACAACCACTACCTGA
Hairpin Sequence:
5'-CCGG-TGCCCGACAACCACTACCTGA-CTCGAG-TCAGGTAGTGGTTGTCGGGCA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTGCCCGACAACCACTACCTGACTCGAGTCAGGTAGTGGTTGTCGGGCATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATGCCCGACAACCACTACCTGACTCGAGTCAGGTAGTGGTTGTCGGGCA-3'

Other clones with same target sequence:

  1. TRCN0000231746