Construct: shRNA TRCN0000072188

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_226s1c1
DNA Barcode:
CCCGACCACATGAAGCAGCAC

Original Target:

Taxon:
Control
Gene:
GFP (GFP)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 226 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072188)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL GFP GFP clonetechGfp clonetechGfp.1 100% CDS 226 0.000 N/A
2 CONTROL BFP BFP Hahn Lab BFP BFP.1 100% CDS 226 0.000 N/A
3 CONTROL eGFP eGFP Hahn Lab eGFP eGFP.1 100% CDS 226 0.000 N/A
4 human 10039 PARP3 poly(ADP-ribose) polymerase... NM_001003931.3 89% 5UTR 90 N/A N/A
5 human 10039 PARP3 poly(ADP-ribose) polymerase... NM_005485.5 89% 5UTR 90 N/A N/A
6 human 10039 PARP3 poly(ADP-ribose) polymerase... XM_005264779.4 89% 5UTR 113 N/A N/A
7 human 10039 PARP3 poly(ADP-ribose) polymerase... XM_017005490.1 89% 5UTR 105 N/A N/A
8 mouse 18548 Pcsk1 proprotein convertase subti... NM_013628.2 89% CDS 1867 N/A N/A
9 mouse 18548 Pcsk1 proprotein convertase subti... XM_006517153.2 89% CDS 1982 N/A N/A
10 mouse 18548 Pcsk1 proprotein convertase subti... XM_006517154.3 89% CDS 1911 N/A N/A
11 mouse 18548 Pcsk1 proprotein convertase subti... XM_006517155.2 89% CDS 1941 N/A N/A
12 mouse 66053 Ppil2 peptidylprolyl isomerase (c... NM_001252444.1 81% CDS 849 N/A N/A
13 mouse 66053 Ppil2 peptidylprolyl isomerase (c... NM_001252445.1 81% CDS 849 N/A N/A
14 mouse 66053 Ppil2 peptidylprolyl isomerase (c... NM_144954.3 81% CDS 849 N/A N/A
15 mouse 11846 Arg1 arginase, liver NM_007482.3 89% 5UTR 58 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCCGACCACATGAAGCAGCAC
Hairpin Sequence:
5'-CCGG-CCCGACCACATGAAGCAGCAC-CTCGAG-GTGCTGCTTCATGTGGTCGGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCCGACCACATGAAGCAGCACCTCGAGGTGCTGCTTCATGTGGTCGGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCCGACCACATGAAGCAGCACCTCGAGGTGCTGCTTCATGTGGTCGGG-3'

Other clones with same target sequence:

  1. TRCN0000231763