Construct: shRNA TRCN0000072192

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_477s1c1
DNA Barcode:
GAACGGCATCAAGGTGAACTT

Original Target:

Original Target:

Taxon:
Control
Gene:
GFP (GFP)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 477 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072192)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL GFP GFP clonetechGfp clonetechGfp.1 100% CDS 477 4.950 N/A
2 CONTROL BFP BFP Hahn Lab BFP BFP.1 95% CDS 477 N/A N/A
3 CONTROL eGFP eGFP Hahn Lab eGFP eGFP.1 95% CDS 477 N/A N/A
4 human 137970 UNC5D unc-5 netrin receptor D NM_001322818.1 89% CDS 2220 N/A N/A
5 human 137970 UNC5D unc-5 netrin receptor D NM_080872.3 89% CDS 2507 N/A N/A
6 human 137970 UNC5D unc-5 netrin receptor D XM_011544400.2 89% CDS 2448 N/A N/A
7 human 137970 UNC5D unc-5 netrin receptor D XM_011544401.2 89% CDS 2442 N/A N/A
8 human 137970 UNC5D unc-5 netrin receptor D XM_011544402.2 89% CDS 2313 N/A N/A
9 human 137970 UNC5D unc-5 netrin receptor D XM_011544403.2 89% CDS 2280 N/A N/A
10 human 137970 UNC5D unc-5 netrin receptor D XM_011544404.2 89% CDS 2274 N/A N/A
11 human 137970 UNC5D unc-5 netrin receptor D XM_017013044.1 89% CDS 2554 N/A N/A
12 human 137970 UNC5D unc-5 netrin receptor D XM_017013045.1 89% CDS 2524 N/A N/A
13 human 137970 UNC5D unc-5 netrin receptor D XM_017013046.1 89% CDS 2521 N/A N/A
14 human 137970 UNC5D unc-5 netrin receptor D XM_017013047.1 89% CDS 2385 N/A N/A
15 human 137970 UNC5D unc-5 netrin receptor D XM_017013048.1 89% CDS 3667 N/A N/A
16 human 137970 UNC5D unc-5 netrin receptor D XM_017013049.1 89% CDS 3618 N/A N/A
17 human 137970 UNC5D unc-5 netrin receptor D XM_017013050.1 89% CDS 3074 N/A N/A
18 human 11116 FGFR1OP FGFR1 oncogene partner NM_001278690.1 90% CDS 186 N/A N/A
19 human 11116 FGFR1OP FGFR1 oncogene partner NM_007045.3 90% CDS 186 N/A N/A
20 human 11116 FGFR1OP FGFR1 oncogene partner NM_194429.2 90% CDS 186 N/A N/A
21 human 94030 LRRC4B leucine rich repeat contain... NM_001080457.1 89% CDS 422 N/A N/A
22 human 94030 LRRC4B leucine rich repeat contain... XM_005259429.4 89% CDS 601 N/A N/A
23 human 94030 LRRC4B leucine rich repeat contain... XM_006723506.3 89% CDS 703 N/A N/A
24 human 94030 LRRC4B leucine rich repeat contain... XM_011527520.2 89% CDS 1849 N/A N/A
25 human 102724826 ZNF337-AS1 ZNF337 antisense RNA 1 NR_126467.1 85% 3UTR 320 N/A N/A
26 mouse 17967 Ncam1 neural cell adhesion molecu... NM_001081445.1 89% CDS 2185 N/A N/A
27 mouse 17967 Ncam1 neural cell adhesion molecu... NM_001113204.1 89% CDS 2185 N/A N/A
28 mouse 17967 Ncam1 neural cell adhesion molecu... NM_001311065.1 89% CDS 2509 N/A N/A
29 mouse 17967 Ncam1 neural cell adhesion molecu... NM_010875.3 89% CDS 2185 N/A N/A
30 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510055.1 89% CDS 2681 N/A N/A
31 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510056.1 89% CDS 2681 N/A N/A
32 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510057.1 89% CDS 2678 N/A N/A
33 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510058.3 89% CDS 2247 N/A N/A
34 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510059.1 89% CDS 2651 N/A N/A
35 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510060.1 89% CDS 2633 N/A N/A
36 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510061.1 89% CDS 2630 N/A N/A
37 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510062.1 89% CDS 2591 N/A N/A
38 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510063.1 89% CDS 2588 N/A N/A
39 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510064.1 89% CDS 2576 N/A N/A
40 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510065.1 89% CDS 2576 N/A N/A
41 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510066.1 89% CDS 2573 N/A N/A
42 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510067.1 89% CDS 2573 N/A N/A
43 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510068.1 89% CDS 2681 N/A N/A
44 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510069.1 89% CDS 2681 N/A N/A
45 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510070.1 89% CDS 2576 N/A N/A
46 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510071.1 89% CDS 2573 N/A N/A
47 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510073.2 89% CDS 2681 N/A N/A
48 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510074.2 89% CDS 2681 N/A N/A
49 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510075.2 89% CDS 2573 N/A N/A
50 mouse 17967 Ncam1 neural cell adhesion molecu... XM_011242413.1 89% CDS 2546 N/A N/A
51 mouse 17967 Ncam1 neural cell adhesion molecu... XM_011242414.1 89% CDS 2546 N/A N/A
52 mouse 17967 Ncam1 neural cell adhesion molecu... XM_011242415.1 89% CDS 2543 N/A N/A
53 mouse 17967 Ncam1 neural cell adhesion molecu... XM_011242416.1 89% CDS 2651 N/A N/A
54 mouse 17967 Ncam1 neural cell adhesion molecu... XM_017313192.1 89% CDS 2561 N/A N/A
55 mouse 17967 Ncam1 neural cell adhesion molecu... XM_017313193.1 89% CDS 2546 N/A N/A
56 mouse 17967 Ncam1 neural cell adhesion molecu... XM_017313194.1 89% CDS 2543 N/A N/A
57 mouse 17967 Ncam1 neural cell adhesion molecu... XM_017313195.1 89% CDS 2573 N/A N/A
58 mouse 17967 Ncam1 neural cell adhesion molecu... XM_017313196.1 89% CDS 2591 N/A N/A
59 mouse 17967 Ncam1 neural cell adhesion molecu... XM_017313197.1 89% CDS 2591 N/A N/A
60 mouse 17967 Ncam1 neural cell adhesion molecu... XM_017313198.1 89% CDS 2573 N/A N/A
61 mouse 17967 Ncam1 neural cell adhesion molecu... XM_017313199.1 89% CDS 2561 N/A N/A
62 mouse 17967 Ncam1 neural cell adhesion molecu... XM_017313200.1 89% CDS 2561 N/A N/A
63 mouse 17967 Ncam1 neural cell adhesion molecu... XM_017313201.1 89% CDS 2546 N/A N/A
64 mouse 21922 Clec3b C-type lectin domain family... NM_011606.2 89% CDS 314 N/A N/A
65 mouse 52666 Arhgef25 Rho guanine nucleotide exch... NM_001166413.1 89% CDS 1371 N/A N/A
66 mouse 52666 Arhgef25 Rho guanine nucleotide exch... NM_028027.3 89% CDS 1433 N/A N/A
67 mouse 52666 Arhgef25 Rho guanine nucleotide exch... XM_006513878.2 89% CDS 1983 N/A N/A
68 mouse 52666 Arhgef25 Rho guanine nucleotide exch... XM_006513879.3 89% CDS 1290 N/A N/A
69 mouse 52666 Arhgef25 Rho guanine nucleotide exch... XM_006513880.1 89% CDS 1345 N/A N/A
70 mouse 52666 Arhgef25 Rho guanine nucleotide exch... XM_006513881.2 89% CDS 1496 N/A N/A
71 mouse 52666 Arhgef25 Rho guanine nucleotide exch... XR_871718.2 89% 3UTR 1486 N/A N/A
72 mouse 75296 Fgfr1op Fgfr1 oncogene partner NM_001197046.1 90% CDS 169 N/A N/A
73 mouse 75296 Fgfr1op Fgfr1 oncogene partner NM_201230.5 90% CDS 169 N/A N/A
74 mouse 75296 Fgfr1op Fgfr1 oncogene partner XM_006523355.2 90% CDS 196 N/A N/A
75 mouse 75296 Fgfr1op Fgfr1 oncogene partner XM_006523356.2 90% CDS 196 N/A N/A
76 mouse 75296 Fgfr1op Fgfr1 oncogene partner XM_006523357.2 90% CDS 196 N/A N/A
77 mouse 14107 Fat1 FAT atypical cadherin 1 NM_001081286.2 89% CDS 5700 N/A N/A
78 mouse 14107 Fat1 FAT atypical cadherin 1 XM_006509267.3 89% CDS 6356 N/A N/A
79 mouse 14107 Fat1 FAT atypical cadherin 1 XM_006509268.3 89% CDS 6027 N/A N/A
80 mouse 14107 Fat1 FAT atypical cadherin 1 XM_006509270.3 89% CDS 6355 N/A N/A
81 mouse 14107 Fat1 FAT atypical cadherin 1 XM_006509271.3 89% CDS 6286 N/A N/A
82 mouse 14107 Fat1 FAT atypical cadherin 1 XM_006509272.3 89% CDS 6355 N/A N/A
83 mouse 14107 Fat1 FAT atypical cadherin 1 XM_006509273.3 89% CDS 6356 N/A N/A
84 mouse 14107 Fat1 FAT atypical cadherin 1 XM_006509274.3 89% CDS 6286 N/A N/A
85 mouse 14107 Fat1 FAT atypical cadherin 1 XM_006509276.3 89% CDS 6357 N/A N/A
86 mouse 14107 Fat1 FAT atypical cadherin 1 XM_006509277.3 89% CDS 6286 N/A N/A
87 mouse 14107 Fat1 FAT atypical cadherin 1 XM_011242173.2 89% CDS 6212 N/A N/A
88 mouse 14107 Fat1 FAT atypical cadherin 1 XM_017312564.1 89% CDS 6356 N/A N/A
89 mouse 14107 Fat1 FAT atypical cadherin 1 XR_001778405.1 89% 3UTR 6357 N/A N/A
90 mouse 380608 Tagap1 T cell activation GTPase ac... NM_147155.2 90% CDS 117 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GAACGGCATCAAGGTGAACTT
Hairpin Sequence:
5'-CCGG-GAACGGCATCAAGGTGAACTT-CTCGAG-AAGTTCACCTTGATGCCGTTC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGAACGGCATCAAGGTGAACTTCTCGAGAAGTTCACCTTGATGCCGTTCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGAACGGCATCAAGGTGAACTTCTCGAGAAGTTCACCTTGATGCCGTTC-3'

Other clones with same target sequence:

  1. TRCN0000231760