Construct: shRNA TRCN0000072221

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_407s1c1
DNA Barcode:
TGCAGAAGAAGACCATGGGCT

Original Target:

Taxon:
Control
Gene:
RFP (RFP)
Gene Description:
RFP
Transcript:
Broad rfp.1 (CURRENT)
Match location:
Position 407 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072221)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL RFP RFP RFP rfp.1 100% CDS 407 0.660 N/A
2 human 23304 UBR2 ubiquitin protein ligase E3... NM_015255.2 89% 3UTR 6107 N/A N/A
3 human 23304 UBR2 ubiquitin protein ligase E3... XM_005248965.4 89% 3UTR 6224 N/A N/A
4 human 23304 UBR2 ubiquitin protein ligase E3... XM_005248966.3 89% 3UTR 5507 N/A N/A
5 human 23304 UBR2 ubiquitin protein ligase E3... XM_011514438.2 89% 3UTR 6307 N/A N/A
6 human 23304 UBR2 ubiquitin protein ligase E3... XM_011514439.1 89% 3UTR 4674 N/A N/A
7 human 23304 UBR2 ubiquitin protein ligase E3... XM_011514440.1 89% 3UTR 4674 N/A N/A
8 human 23304 UBR2 ubiquitin protein ligase E3... XM_011514441.2 89% 3UTR 4287 N/A N/A
9 human 23304 UBR2 ubiquitin protein ligase E3... XM_017010594.1 89% 3UTR 6308 N/A N/A
10 human 23304 UBR2 ubiquitin protein ligase E3... XM_017010595.1 89% 3UTR 6305 N/A N/A
11 human 23304 UBR2 ubiquitin protein ligase E3... XM_017010596.1 89% 3UTR 6139 N/A N/A
12 human 23304 UBR2 ubiquitin protein ligase E3... XR_001743284.1 89% 3UTR 6464 N/A N/A
13 human 124222 PAQR4 progestin and adipoQ recept... NM_001284511.1 89% 3UTR 2039 N/A N/A
14 human 124222 PAQR4 progestin and adipoQ recept... NM_001284512.1 89% 3UTR 1934 N/A N/A
15 human 124222 PAQR4 progestin and adipoQ recept... NM_001284513.1 89% 3UTR 1662 N/A N/A
16 human 124222 PAQR4 progestin and adipoQ recept... NM_001324118.1 89% 3UTR 1955 N/A N/A
17 human 124222 PAQR4 progestin and adipoQ recept... NM_152341.4 89% 3UTR 2156 N/A N/A
18 human 84074 QRICH2 glutamine rich 2 NM_032134.2 86% CDS 312 N/A N/A
19 human 84074 QRICH2 glutamine rich 2 NR_130649.1 86% 3UTR 312 N/A N/A
20 human 84074 QRICH2 glutamine rich 2 XM_005257728.3 86% CDS 1322 N/A N/A
21 human 84074 QRICH2 glutamine rich 2 XM_017025206.1 86% CDS 1322 N/A N/A
22 human 84074 QRICH2 glutamine rich 2 XM_017025207.1 86% CDS 1262 N/A N/A
23 human 84074 QRICH2 glutamine rich 2 XM_017025208.1 86% 5UTR 400 N/A N/A
24 human 56907 SPIRE1 spire type actin nucleation... XM_011525703.2 89% CDS 758 N/A N/A
25 human 105376751 LOC105376751 uncharacterized LOC105376751 XR_933149.2 90% 3UTR 219 N/A N/A
26 human 105371109 LOC105371109 uncharacterized LOC105371109 XR_916959.2 90% 3UTR 219 N/A N/A
27 human 105371105 LOC105371105 uncharacterized LOC105371105 XR_916951.2 90% 3UTR 219 N/A N/A
28 human 105371105 LOC105371105 uncharacterized LOC105371105 XR_933139.2 90% 3UTR 219 N/A N/A
29 human 105371105 LOC105371105 uncharacterized LOC105371105 XR_951934.2 90% 3UTR 219 N/A N/A
30 human 105375643 LOC105375643 uncharacterized LOC105375643 XR_001746003.1 89% 3UTR 1010 N/A N/A
31 human 105375643 LOC105375643 uncharacterized LOC105375643 XR_001759094.1 89% 3UTR 1010 N/A N/A
32 human 105378467 LOC105378467 uncharacterized LOC105378467 XR_946289.1 85% 3UTR 61 N/A N/A
33 human 105378467 LOC105378467 uncharacterized LOC105378467 XR_959843.1 85% 3UTR 61 N/A N/A
34 human 105371097 LOC105371097 uncharacterized LOC105371097 XR_916923.2 90% 3UTR 223 N/A N/A
35 human 105371097 LOC105371097 uncharacterized LOC105371097 XR_933125.2 90% 3UTR 223 N/A N/A
36 human 105371097 LOC105371097 uncharacterized LOC105371097 XR_951911.2 90% 3UTR 223 N/A N/A
37 mouse 75753 Klf17 Kruppel-like factor 17 NM_029416.2 89% 3UTR 2885 N/A N/A
38 mouse 83762 Otof otoferlin NM_001100395.1 85% CDS 645 N/A N/A
39 mouse 230866 Emc1 ER membrane protein complex... NM_001039200.2 89% CDS 2357 N/A N/A
40 mouse 230866 Emc1 ER membrane protein complex... NM_146157.4 89% CDS 2366 N/A N/A
41 mouse 28064 Yipf3 Yip1 domain family, member 3 NM_145353.2 89% CDS 372 N/A N/A
42 mouse 28064 Yipf3 Yip1 domain family, member 3 XM_006524377.3 89% CDS 367 N/A N/A
43 mouse 28064 Yipf3 Yip1 domain family, member 3 XM_017317498.1 89% 5UTR 27 N/A N/A
44 mouse 667507 Gm8674 predicted gene 8674 XM_017315659.1 85% CDS 3158 N/A N/A
45 mouse 100415784 Gm17830 predicted gene, 17830 NR_033486.1 85% 3UTR 1482 N/A N/A
46 mouse 102640311 Gm36410 predicted gene, 36410 XR_383497.2 89% 3UTR 83 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TGCAGAAGAAGACCATGGGCT
Hairpin Sequence:
5'-CCGG-TGCAGAAGAAGACCATGGGCT-CTCGAG-AGCCCATGGTCTTCTTCTGCA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTGCAGAAGAAGACCATGGGCTCTCGAGAGCCCATGGTCTTCTTCTGCATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATGCAGAAGAAGACCATGGGCTCTCGAGAGCCCATGGTCTTCTTCTGCA-3'

Other clones with same target sequence:

  1. TRCN0000231687