Construct: shRNA TRCN0000231731

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_34s21c1
DNA Barcode:
GCGCCATTCTATCCGCTGGAA

Original Target:

Original Target:

Taxon:
Control
Gene:
LUCIFERASE (LUCIFERASE)
Gene Description:
promegaLuc
Transcript:
Broad promegaLuc.1 (CURRENT)
Match location:
Position 34 (CDS)

Vector Information:

Vector Backbone:
pLKO_TRC005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000231731)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL LUCIFERASE LUCIFERASE promegaLuc promegaLuc.1 100% CDS 34 0.880 N/A
2 CONTROL Luciferase Luciferase Hahn Lab Luciferase Luciferase.1 100% CDS 34 0.880 N/A
3 mouse 18198 Musk muscle, skeletal, receptor ... NM_001037127.2 85% CDS 2507 N/A N/A
4 mouse 18198 Musk muscle, skeletal, receptor ... NM_001037128.1 85% CDS 2462 N/A N/A
5 mouse 18198 Musk muscle, skeletal, receptor ... NM_001037129.1 85% CDS 2438 N/A N/A
6 mouse 18198 Musk muscle, skeletal, receptor ... NM_001037130.1 85% CDS 2408 N/A N/A
7 mouse 18198 Musk muscle, skeletal, receptor ... NM_010944.2 85% CDS 2432 N/A N/A
8 mouse 18198 Musk muscle, skeletal, receptor ... XM_006537659.2 85% CDS 2729 N/A N/A
9 mouse 18198 Musk muscle, skeletal, receptor ... XM_006537661.2 85% CDS 2705 N/A N/A
10 mouse 230959 Ajap1 adherens junction associate... NM_001099299.1 90% CDS 702 N/A N/A
11 mouse 230959 Ajap1 adherens junction associate... XM_006538824.3 90% CDS 1900 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GCGCCATTCTATCCGCTGGAA
Hairpin Sequence:
5'-CCGG-GCGCCATTCTATCCGCTGGAA-CTCGAG-TTCCAGCGGATAGAATGGCGC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCGCCATTCTATCCGCTGGAACTCGAGTTCCAGCGGATAGAATGGCGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCGCCATTCTATCCGCTGGAACTCGAGTTCCAGCGGATAGAATGGCGC-3'

Other clones with same target sequence:

  1. TRCN0000072267