Gene: BFP (BFP)

Hahn Lab BFP

Wildtype Transcripts:

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene BFP (BFP), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene BFP (BFP), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 BRDN0000464762 CONTROL BFP.1 BFP BFP pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99985 CONTROL BFP.1 BFP BFP pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99986 CONTROL BFP.1 BFP BFP pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99987 CONTROL BFP.1 BFP BFP pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99980 CONTROL BFP.1 BFP BFP pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99986 CONTROL BFP.1 BFP BFP pLX_TRC304 82.4% 100% 100% V5 N/A
7 BRDN0000464777 CONTROL BFP.1 BFP BFP pLX_TRC302 0% 100% 100% V5 N/A
9 ccsbBroad304_99985 CONTROL BFP.1 BFP BFP pLX_TRC304 72.2% 99.8% 99.5% V5 (not translated due to prior stop codon) 716A>N
10 ccsbBroad304_99987 CONTROL BFP.1 BFP BFP pLX_TRC304 88.7% 99.7% 23.8% V5 (not translated due to frame shift) 99delG;116delC
11 BRDN0000464763 CONTROL BFP.1 BFP BFP pDONR223 0% 100% 100% None N/A
12 BRDN0000464764 CONTROL BFP.1 BFP BFP pDONR223 0% 100% 100% None N/A
13 ccsbBroad301_99998 CONTROL BFP.1 BFP BFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
14 ccsbBroad301_99999 CONTROL BFP.1 BFP BFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
15 ccsbBroad301_99984 CONTROL BFP.1 BFP BFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
16 ccsbBroad301_99997 CONTROL BFP.1 BFP BFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
17 ccsbBroad304_99999 CONTROL BFP.1 BFP BFP pLX_TRC304 72.2% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
18 ccsbBroad304_99998 CONTROL BFP.1 BFP BFP pLX_TRC304 71.7% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
19 ccsbBroad304_99997 CONTROL BFP.1 BFP BFP pLX_TRC304 71.7% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
20 BRDN0000559443 CONTROL BFP.1 BFP BFP pLX_TRC307 0% 99.1% 98.3% V5 (many diffs)
21 BRDN0000464774 CONTROL BFP.1 BFP BFP pDONR221 0% 99.1% 98.3% None (many diffs)
22 BRDN0000464781 CONTROL BFP.1 BFP BFP pLX_TRC302 0% 99.1% 98.3% V5 (many diffs)
23 BRDN0000556273 CONTROL BFP.1 BFP BFP pLX_TRC303 0% 99.1% 98.3% None (many diffs)
24 BRDN0000556285 CONTROL BFP.1 BFP BFP pLX_TRC305 0% 99.1% 98.3% None (many diffs)
25 BRDN0000556297 CONTROL BFP.1 BFP BFP pLX_TRC306 0% 99.1% 98.3% V5 (many diffs)
26 BRDN0000556276 CONTROL BFP.1 BFP BFP pLXI_TRC401 0% 99.1% 98.3% None (many diffs)
27 BRDN0000556271 CONTROL BFP.1 BFP BFP pLXI_TRC402 0% 99.1% 98.3% HA (many diffs)
28 BRDN0000556283 CONTROL BFP.1 BFP BFP pLX_TRC311 0% 99.1% 98.3% V5 (many diffs)
29 BRDN0000556281 CONTROL BFP.1 BFP BFP pLX_TRC313 0% 99.1% 98.3% V5 (many diffs)
30 BRDN0000556292 CONTROL BFP.1 BFP BFP pLX_TRC314 0% 99.1% 98.3% V5 (many diffs)
31 BRDN0000556298 CONTROL BFP.1 BFP BFP pLX_TRC315 0% 99.1% 98.3% V5 (many diffs)
32 BRDN0000556286 CONTROL BFP.1 BFP BFP pLXI_TRC403 0% 99.1% 98.3% V5 (many diffs)
33 BRDN0000559466 CONTROL BFP.1 BFP BFP ATCGATTTTGTATTTGGAGGCCCT pLX_TRC317 70% 99.1% 98.3% V5 (many diffs)
34 BRDN0000464775 CONTROL BFP.1 BFP BFP pDONR221 0% 99.1% 98.3% None (many diffs)
35 BRDN0000464776 CONTROL BFP.1 BFP BFP pDONR221 0% 99.1% 98.3% None (many diffs)
Download CSV