Gene: GFP (GFP)


Wildtype Transcripts:

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene GFP (GFP), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072181 ACAACAGCCACAACGTCTATA pLKO.1 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
2 TRCN0000231753 ACAACAGCCACAACGTCTATA pLKO_TRC005 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
3 TRCN0000559393 ACAACAGCCACAACGTCTATA pLKO_TRC024 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
4 TRCN0000559394 ACAACAGCCACAACGTCTATA pLKO_TRC047 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
5 TRCN0000559395 ACAACAGCCACAACGTCTATA pLKO_TRC022 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
6 TRCN0000559396 ACAACAGCCACAACGTCTATA pLKO_TRC018 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
7 TRCN0000559397 ACAACAGCCACAACGTCTATA pLKO_TRC016 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
8 TRCN0000559399 ACAACAGCCACAACGTCTATA pLKO_TRC023 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
9 TRCN0000559401 ACAACAGCCACAACGTCTATA pLKO_TRC008 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
10 TRCN0000559403 ACAACAGCCACAACGTCTATA pLKO_TRC046 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
11 TRCN0000559407 ACAACAGCCACAACGTCTATA pLKO_TRC017 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
12 TRCN0000559408 ACAACAGCCACAACGTCTATA pLKO_TRC021 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
13 TRCN0000072178 CAACAGCCACAACGTCTATAT pLKO.1 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
14 TRCN0000231750 CAACAGCCACAACGTCTATAT pLKO_TRC005 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
15 TRCN0000072193 CGACGTAAACGGCCACAAGTT pLKO.1 clonetechGfp.1 CDS 100% 4.950 N/A N/A GFP
16 TRCN0000231761 CGACGTAAACGGCCACAAGTT pLKO_TRC005 clonetechGfp.1 CDS 100% 4.950 N/A N/A GFP
17 TRCN0000072192 GAACGGCATCAAGGTGAACTT pLKO.1 clonetechGfp.1 CDS 100% 4.950 N/A N/A GFP
18 TRCN0000231760 GAACGGCATCAAGGTGAACTT pLKO_TRC005 clonetechGfp.1 CDS 100% 4.950 N/A N/A GFP
19 TRCN0000072185 TACAACAGCCACAACGTCTAT pLKO.1 clonetechGfp.1 CDS 100% 4.950 N/A N/A GFP
20 TRCN0000231747 TACAACAGCCACAACGTCTAT pLKO_TRC005 clonetechGfp.1 CDS 100% 4.950 N/A N/A GFP
21 TRCN0000072194 CCACATGAAGCAGCACGACTT pLKO.1 clonetechGfp.1 CDS 100% 4.050 N/A N/A GFP
22 TRCN0000231762 CCACATGAAGCAGCACGACTT pLKO_TRC005 clonetechGfp.1 CDS 100% 4.050 N/A N/A GFP
23 TRCN0000072180 CTATATCATGGCCGACAAGCA pLKO.1 clonetechGfp.1 CDS 100% 2.640 N/A N/A GFP
24 TRCN0000231754 CTATATCATGGCCGACAAGCA pLKO_TRC005 clonetechGfp.1 CDS 100% 2.640 N/A N/A GFP
25 TRCN0000072199 TGACCCTGAAGTTCATCTGCA pLKO.1 clonetechGfp.1 CDS 100% 2.640 N/A N/A GFP
26 TRCN0000231745 TGACCCTGAAGTTCATCTGCA pLKO_TRC005 clonetechGfp.1 CDS 100% 2.640 N/A N/A GFP
27 TRCN0000072196 ACGTCTATATCATGGCCGACA pLKO.1 clonetechGfp.1 CDS 100% 2.160 N/A N/A GFP
28 TRCN0000231756 ACGTCTATATCATGGCCGACA pLKO_TRC005 clonetechGfp.1 CDS 100% 2.160 N/A N/A GFP
29 TRCN0000072200 AGTACAACTACAACAGCCACA pLKO.1 clonetechGfp.1 CDS 100% 2.160 N/A N/A GFP
30 TRCN0000231744 AGTACAACTACAACAGCCACA pLKO_TRC005 clonetechGfp.1 CDS 100% 2.160 N/A N/A GFP
31 TRCN0000072183 CGGCATGGACGAGCTGTACAA pLKO.1 clonetechGfp.1 CDS 100% 1.650 N/A N/A GFP
32 TRCN0000231751 CGGCATGGACGAGCTGTACAA pLKO_TRC005 clonetechGfp.1 CDS 100% 1.650 N/A N/A GFP
33 TRCN0000072195 GCGACGTAAACGGCCACAAGT pLKO.1 clonetechGfp.1 CDS 100% 1.650 N/A N/A GFP
34 TRCN0000231755 GCGACGTAAACGGCCACAAGT pLKO_TRC005 clonetechGfp.1 CDS 100% 1.650 N/A N/A GFP
35 TRCN0000072197 CTACGGCAAGCTGACCCTGAA pLKO.1 clonetechGfp.1 CDS 100% 1.350 N/A N/A GFP
36 TRCN0000231757 CTACGGCAAGCTGACCCTGAA pLKO_TRC005 clonetechGfp.1 CDS 100% 1.350 N/A N/A GFP
37 TRCN0000072182 TCTCGGCATGGACGAGCTGTA pLKO.1 clonetechGfp.1 CDS 100% 1.350 N/A N/A GFP
38 TRCN0000231752 TCTCGGCATGGACGAGCTGTA pLKO_TRC005 clonetechGfp.1 CDS 100% 1.350 N/A N/A GFP
39 TRCN0000072186 TGCCCGACAACCACTACCTGA pLKO.1 clonetechGfp.1 CDS 100% 0.880 N/A N/A GFP
40 TRCN0000231746 TGCCCGACAACCACTACCTGA pLKO_TRC005 clonetechGfp.1 CDS 100% 0.880 N/A N/A GFP
41 TRCN0000072179 CGACCACATGAAGCAGCACGA pLKO.1 clonetechGfp.1 CDS 100% 0.720 N/A N/A GFP
42 TRCN0000231749 CGACCACATGAAGCAGCACGA pLKO_TRC005 clonetechGfp.1 CDS 100% 0.720 N/A N/A GFP
43 TRCN0000072190 GACCACATGAAGCAGCACGAC pLKO.1 clonetechGfp.1 CDS 100% 0.720 N/A N/A GFP
44 TRCN0000231759 GACCACATGAAGCAGCACGAC pLKO_TRC005 clonetechGfp.1 CDS 100% 0.720 N/A N/A GFP
45 TRCN0000206973 GCACGACTTCTTCAAGTCCGC pLKO.1 clonetechGfp.1 CDS 100% 0.018 N/A N/A GFP
46 TRCN0000207152 AGTTCGTGACCGCCGCCGGGA pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
47 TRCN0000072188 CCCGACCACATGAAGCAGCAC pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
48 TRCN0000231763 CCCGACCACATGAAGCAGCAC pLKO_TRC005 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
49 TRCN0000072189 CCTACGGCGTGCAGTGCTTCA pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
50 TRCN0000231765 CCTACGGCGTGCAGTGCTTCA pLKO_TRC005 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
51 TRCN0000072184 CGGGATCACTCTCGGCATGGA pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
52 TRCN0000231748 CGGGATCACTCTCGGCATGGA pLKO_TRC005 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
53 TRCN0000072187 CTCTCGGCATGGACGAGCTGT pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
54 TRCN0000231764 CTCTCGGCATGGACGAGCTGT pLKO_TRC005 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
55 TRCN0000207020 GACCACCCTGACCTACGGCGT pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
56 TRCN0000072202 GCCACAACATCGAGGACGGCA pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
57 TRCN0000231705 GCCACAACATCGAGGACGGCA pLKO_TRC005 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
58 TRCN0000207065 GCGATCACATGGTCCTGCTGG pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
59 TRCN0000072198 GCGCGATCACATGGTCCTGCT pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
60 TRCN0000231758 GCGCGATCACATGGTCCTGCT pLKO_TRC005 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
61 TRCN0000207257 GCTGTTCACCGGGGTGGTGCC pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
62 TRCN0000072201 GTCGAGCTGGACGGCGACGTA pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
63 TRCN0000207114 TCCGCCCTGAGCAAAGACCCC pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene GFP (GFP), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 ccsbBroad301_99998 CONTROL clonetechGfp.1 GFP GFP pLX_TRC301 0% 99.7% 99.5% None 93C>T;491T>C
2 ccsbBroad301_99984 CONTROL clonetechGfp.1 GFP GFP pLX_TRC301 0% 99.7% 99.5% None 93C>T;491T>C
3 ccsbBroad301_99999 CONTROL clonetechGfp.1 GFP GFP pLX_TRC301 0% 99.7% 99.5% None 93C>T;491T>C
4 ccsbBroad301_99997 CONTROL clonetechGfp.1 GFP GFP pLX_TRC301 0% 99.7% 99.5% None 93C>T;491T>C
5 ccsbBroad304_99999 CONTROL clonetechGfp.1 GFP GFP pLX_TRC304 72.2% 99.7% 99.5% V5 (not translated due to frame shift) 93C>T;491T>C
6 ccsbBroad304_99998 CONTROL clonetechGfp.1 GFP GFP pLX_TRC304 71.7% 99.7% 99.5% V5 (not translated due to frame shift) 93C>T;491T>C
7 ccsbBroad304_99997 CONTROL clonetechGfp.1 GFP GFP pLX_TRC304 71.7% 99.7% 99.5% V5 (not translated due to frame shift) 93C>T;491T>C
8 BRDN0000559443 CONTROL clonetechGfp.1 GFP GFP pLX_TRC307 0% 99.7% 99.5% V5 93C>T;491T>C
9 BRDN0000464774 CONTROL clonetechGfp.1 GFP GFP pDONR221 0% 99.7% 99.5% None 93C>T;491T>C
10 BRDN0000464781 CONTROL clonetechGfp.1 GFP GFP pLX_TRC302 0% 99.7% 99.5% V5 93C>T;491T>C
11 BRDN0000556273 CONTROL clonetechGfp.1 GFP GFP pLX_TRC303 0% 99.7% 99.5% None 93C>T;491T>C
12 BRDN0000556285 CONTROL clonetechGfp.1 GFP GFP pLX_TRC305 0% 99.7% 99.5% None 93C>T;491T>C
13 BRDN0000556297 CONTROL clonetechGfp.1 GFP GFP pLX_TRC306 0% 99.7% 99.5% V5 93C>T;491T>C
14 BRDN0000556276 CONTROL clonetechGfp.1 GFP GFP pLXI_TRC401 0% 99.7% 99.5% None 93C>T;491T>C
15 BRDN0000556271 CONTROL clonetechGfp.1 GFP GFP pLXI_TRC402 0% 99.7% 99.5% HA 93C>T;491T>C
16 BRDN0000556283 CONTROL clonetechGfp.1 GFP GFP pLX_TRC311 0% 99.7% 99.5% V5 93C>T;491T>C
17 BRDN0000556281 CONTROL clonetechGfp.1 GFP GFP pLX_TRC313 0% 99.7% 99.5% V5 93C>T;491T>C
18 BRDN0000556292 CONTROL clonetechGfp.1 GFP GFP pLX_TRC314 0% 99.7% 99.5% V5 93C>T;491T>C
19 BRDN0000556298 CONTROL clonetechGfp.1 GFP GFP pLX_TRC315 0% 99.7% 99.5% V5 93C>T;491T>C
20 BRDN0000556286 CONTROL clonetechGfp.1 GFP GFP pLXI_TRC403 0% 99.7% 99.5% V5 93C>T;491T>C
21 BRDN0000559466 CONTROL clonetechGfp.1 GFP GFP ATCGATTTTGTATTTGGAGGCCCT pLX_TRC317 70% 99.7% 99.5% V5 93C>T;491T>C
22 BRDN0000464775 CONTROL clonetechGfp.1 GFP GFP pDONR221 0% 99.7% 99.5% None 93C>T;491T>C
23 BRDN0000464776 CONTROL clonetechGfp.1 GFP GFP pDONR221 0% 99.7% 99.5% None 93C>T;491T>C
24 BRDN0000464762 CONTROL clonetechGfp.1 GFP GFP pDONR223 0% 99.1% 97.9% None (many diffs)
25 ccsbBroad301_99985 CONTROL clonetechGfp.1 GFP GFP pLX_TRC301 0% 99.1% 97.9% None (many diffs)
26 ccsbBroad301_99986 CONTROL clonetechGfp.1 GFP GFP pLX_TRC301 0% 99.1% 97.9% None (many diffs)
27 ccsbBroad301_99987 CONTROL clonetechGfp.1 GFP GFP pLX_TRC301 0% 99.1% 97.9% None (many diffs)
28 ccsbBroad301_99980 CONTROL clonetechGfp.1 GFP GFP pLX_TRC301 0% 99.1% 97.9% None (many diffs)
29 ccsbBroad304_99986 CONTROL clonetechGfp.1 GFP GFP pLX_TRC304 82.4% 99.1% 97.9% V5 (many diffs)
30 BRDN0000464777 CONTROL clonetechGfp.1 GFP GFP pLX_TRC302 0% 99.1% 97.9% V5 (many diffs)
31 BRDN0000559460 CONTROL clonetechGfp.1 GFP GFP TAGAGATTGGGTTCAACCTGGAAG pLX_TRC317 61.8% 99.1% 97.9% V5 (many diffs)
32 ccsbBroad304_99985 CONTROL clonetechGfp.1 GFP GFP pLX_TRC304 72.2% 99% 97.4% V5 (not translated due to prior stop codon) (many diffs)
33 ccsbBroad304_99987 CONTROL clonetechGfp.1 GFP GFP pLX_TRC304 88.7% 98.8% 23.1% V5 (not translated due to frame shift) (many diffs)
34 BRDN0000464763 CONTROL clonetechGfp.1 GFP GFP pDONR223 0% 99.1% 97.9% None (many diffs)
35 BRDN0000464764 CONTROL clonetechGfp.1 GFP GFP pDONR223 0% 99.1% 97.9% None (many diffs)
Download CSV