Gene: HcRed (HcRed)

Hahn Lab HcRed

Wildtype Transcripts:

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene HcRed (HcRed), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

No results found.

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene HcRed (HcRed), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 BRDN0000464765 CONTROL HcRed.1 HcRed HcRed pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99989 CONTROL HcRed.1 HcRed HcRed pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99990 CONTROL HcRed.1 HcRed HcRed pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99988 CONTROL HcRed.1 HcRed HcRed pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99981 CONTROL HcRed.1 HcRed HcRed pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99990 CONTROL HcRed.1 HcRed HcRed pLX_TRC304 75.8% 100% 100% V5 N/A
7 BRDN0000559442 CONTROL HcRed.1 HcRed HcRed pLX_TRC307 0% 100% 100% V5 N/A
8 BRDN0000464778 CONTROL HcRed.1 HcRed HcRed pLX_TRC302 0% 100% 100% V5 N/A
9 BRDN0000556267 CONTROL HcRed.1 HcRed HcRed pLX_TRC303 0% 100% 100% None N/A
10 BRDN0000556265 CONTROL HcRed.1 HcRed HcRed pLX_TRC305 0% 100% 100% None N/A
11 BRDN0000556269 CONTROL HcRed.1 HcRed HcRed pLX_TRC306 0% 100% 100% V5 N/A
12 BRDN0000556261 CONTROL HcRed.1 HcRed HcRed pLXI_TRC401 0% 100% 100% None N/A
13 BRDN0000556287 CONTROL HcRed.1 HcRed HcRed pLXI_TRC402 0% 100% 100% HA N/A
14 BRDN0000556264 CONTROL HcRed.1 HcRed HcRed pLX_TRC311 0% 100% 100% V5 N/A
15 BRDN0000556295 CONTROL HcRed.1 HcRed HcRed pLX_TRC312 0% 100% 100% V5 N/A
16 BRDN0000556268 CONTROL HcRed.1 HcRed HcRed pLX_TRC313 0% 100% 100% V5 N/A
17 BRDN0000556263 CONTROL HcRed.1 HcRed HcRed pLX_TRC314 0% 100% 100% V5 N/A
18 BRDN0000556284 CONTROL HcRed.1 HcRed HcRed pLX_TRC315 0% 100% 100% V5 N/A
19 BRDN0000556260 CONTROL HcRed.1 HcRed HcRed pLXI_TRC403 0% 100% 100% V5 N/A
20 BRDN0000559463 CONTROL HcRed.1 HcRed HcRed TGCTATCACCACCGTACAGGTCCC pLX_TRC317 72.2% 100% 100% V5 N/A
21 ccsbBroad304_99988 CONTROL HcRed.1 HcRed HcRed pLX_TRC304 76.9% 70.1% 41.2% V5 (not translated due to prior stop codon) (many diffs)
22 BRDN0000464766 CONTROL HcRed.1 HcRed HcRed pDONR223 0% 100% 100% None N/A
23 BRDN0000464767 CONTROL HcRed.1 HcRed HcRed pDONR223 0% 100% 100% None N/A
Download CSV