Gene: eGFP (eGFP)

Hahn Lab eGFP

Wildtype Transcripts:

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene eGFP (eGFP), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene eGFP (eGFP), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 ccsbBroad301_99984 CONTROL eGFP.1 eGFP eGFP pLX_TRC301 0% 100% 100% None N/A
2 ccsbBroad301_99997 CONTROL eGFP.1 eGFP eGFP pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99998 CONTROL eGFP.1 eGFP eGFP pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99999 CONTROL eGFP.1 eGFP eGFP pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad304_99997 CONTROL eGFP.1 eGFP eGFP pLX_TRC304 71.7% 100% 100% V5 (not translated due to frame shift) N/A
6 ccsbBroad304_99998 CONTROL eGFP.1 eGFP eGFP pLX_TRC304 71.7% 100% 100% V5 (not translated due to frame shift) N/A
7 ccsbBroad304_99999 CONTROL eGFP.1 eGFP eGFP pLX_TRC304 72.2% 100% 100% V5 (not translated due to frame shift) N/A
8 BRDN0000559443 CONTROL eGFP.1 eGFP eGFP pLX_TRC307 0% 100% 100% V5 N/A
9 BRDN0000464774 CONTROL eGFP.1 eGFP eGFP pDONR221 0% 100% 100% None N/A
10 BRDN0000464781 CONTROL eGFP.1 eGFP eGFP pLX_TRC302 0% 100% 100% V5 N/A
11 BRDN0000556273 CONTROL eGFP.1 eGFP eGFP pLX_TRC303 0% 100% 100% None N/A
12 BRDN0000556285 CONTROL eGFP.1 eGFP eGFP pLX_TRC305 0% 100% 100% None N/A
13 BRDN0000556297 CONTROL eGFP.1 eGFP eGFP pLX_TRC306 0% 100% 100% V5 N/A
14 BRDN0000556276 CONTROL eGFP.1 eGFP eGFP pLXI_TRC401 0% 100% 100% None N/A
15 BRDN0000556271 CONTROL eGFP.1 eGFP eGFP pLXI_TRC402 0% 100% 100% HA N/A
16 BRDN0000556283 CONTROL eGFP.1 eGFP eGFP pLX_TRC311 0% 100% 100% V5 N/A
17 BRDN0000556281 CONTROL eGFP.1 eGFP eGFP pLX_TRC313 0% 100% 100% V5 N/A
18 BRDN0000556292 CONTROL eGFP.1 eGFP eGFP pLX_TRC314 0% 100% 100% V5 N/A
19 BRDN0000556298 CONTROL eGFP.1 eGFP eGFP pLX_TRC315 0% 100% 100% V5 N/A
20 BRDN0000556286 CONTROL eGFP.1 eGFP eGFP pLXI_TRC403 0% 100% 100% V5 N/A
22 BRDN0000464775 CONTROL eGFP.1 eGFP eGFP pDONR221 0% 100% 100% None N/A
23 BRDN0000464776 CONTROL eGFP.1 eGFP eGFP pDONR221 0% 100% 100% None N/A
24 BRDN0000464762 CONTROL eGFP.1 eGFP eGFP pDONR223 0% 99.1% 98.3% None (many diffs)
25 ccsbBroad301_99980 CONTROL eGFP.1 eGFP eGFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
26 ccsbBroad301_99985 CONTROL eGFP.1 eGFP eGFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
27 ccsbBroad301_99986 CONTROL eGFP.1 eGFP eGFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
28 ccsbBroad301_99987 CONTROL eGFP.1 eGFP eGFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
29 ccsbBroad304_99986 CONTROL eGFP.1 eGFP eGFP pLX_TRC304 82.4% 99.1% 98.3% V5 (many diffs)
30 BRDN0000464777 CONTROL eGFP.1 eGFP eGFP pLX_TRC302 0% 99.1% 98.3% V5 (many diffs)
31 BRDN0000559460 CONTROL eGFP.1 eGFP eGFP TAGAGATTGGGTTCAACCTGGAAG pLX_TRC317 61.8% 99.1% 98.3% V5 (many diffs)
32 ccsbBroad304_99985 CONTROL eGFP.1 eGFP eGFP pLX_TRC304 72.2% 99% 97.9% V5 (not translated due to prior stop codon) (many diffs)
33 ccsbBroad304_99987 CONTROL eGFP.1 eGFP eGFP pLX_TRC304 88.7% 98.8% 23.5% V5 (not translated due to frame shift) (many diffs)
34 BRDN0000464763 CONTROL eGFP.1 eGFP eGFP pDONR223 0% 99.1% 98.3% None (many diffs)
35 BRDN0000464764 CONTROL eGFP.1 eGFP eGFP pDONR223 0% 99.1% 98.3% None (many diffs)
Download CSV