Transcript: HcRed.1

Hahn Lab far-red fluorescent protein

HcRed (HcRed)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to HcRed.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript HcRed.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 BRDN0000464765 pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99981 pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99988 pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99989 pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99990 pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99990 pLX_TRC304 75.8% 100% 100% V5 N/A
7 BRDN0000559442 pLX_TRC307 0% 100% 100% V5 N/A
8 BRDN0000464778 pLX_TRC302 0% 100% 100% V5 N/A
9 BRDN0000556267 pLX_TRC303 0% 100% 100% None N/A
10 BRDN0000556265 pLX_TRC305 0% 100% 100% None N/A
11 BRDN0000556269 pLX_TRC306 0% 100% 100% V5 N/A
12 BRDN0000556261 pLXI_TRC401 0% 100% 100% None N/A
13 BRDN0000556287 pLXI_TRC402 0% 100% 100% HA N/A
14 BRDN0000556264 pLX_TRC311 0% 100% 100% V5 N/A
15 BRDN0000556295 pLX_TRC312 0% 100% 100% V5 N/A
16 BRDN0000556268 pLX_TRC313 0% 100% 100% V5 N/A
17 BRDN0000556263 pLX_TRC314 0% 100% 100% V5 N/A
18 BRDN0000556284 pLX_TRC315 0% 100% 100% V5 N/A
19 BRDN0000556260 pLXI_TRC403 0% 100% 100% V5 N/A
20 BRDN0000559463 TGCTATCACCACCGTACAGGTCCC pLX_TRC317 72.2% 100% 100% V5 N/A
21 ccsbBroad304_99988 pLX_TRC304 76.9% 70.1% 41.2% V5 (not translated due to prior stop codon) (many diffs)
22 BRDN0000464766 pDONR223 0% 100% 100% None N/A
23 BRDN0000464767 pDONR223 0% 100% 100% None N/A
Download CSV