Transcript: Luciferase.1

Hahn Lab luciferase cloned from BD pTAL-luc

Luciferase (Luciferase)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Luciferase.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other CONTROL Gene? Orig. Target Gene[?]
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript Luciferase.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 BRDN0000464768 pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99982 pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99993 pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99992 pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99991 pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99992 pLX_TRC304 18.9% 100% 100% V5 N/A
7 ccsbBroad304_99991 pLX_TRC304 18.9% 100% 100% V5 N/A
8 BRDN0000559440 pLX_TRC307 0% 100% 100% V5 N/A
9 BRDN0000464779 pLX_TRC302 0% 100% 100% V5 N/A
10 BRDN0000556282 pLX_TRC303 0% 100% 100% None N/A
11 BRDN0000556262 pLX_TRC305 0% 100% 100% None N/A
12 BRDN0000556299 pLX_TRC306 0% 100% 100% V5 N/A
13 BRDN0000556280 pLXI_TRC401 0% 100% 100% None N/A
14 BRDN0000556275 pLXI_TRC402 0% 100% 100% HA N/A
15 BRDN0000556301 pLX_TRC311 0% 100% 100% V5 N/A
16 BRDN0000556296 pLX_TRC312 0% 100% 100% V5 N/A
17 BRDN0000556302 pLX_TRC313 0% 100% 100% V5 N/A
18 BRDN0000556293 pLX_TRC314 0% 100% 100% V5 N/A
19 BRDN0000556270 pLX_TRC315 0% 100% 100% V5 N/A
20 BRDN0000556289 pLXI_TRC403 0% 100% 100% V5 N/A
21 BRDN0000559468 CTAATATACAACCGATTAATCATC pLX_TRC317 30.3% 100% 100% V5 N/A
22 ccsbBroad304_99993 pLX_TRC304 44.2% 76.8% 56.5% V5 (not translated due to prior stop codon) (many diffs)
23 BRDN0000464769 pDONR223 0% 100% 100% None N/A
24 BRDN0000464770 pDONR223 0% 100% 100% None N/A
Download CSV