Transcript: Mouse XM_017321343.1

PREDICTED: Mus musculus phospholipase C, zeta 1 (Plcz1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plcz1 (114875)
Length:
3420
CDS:
525..2264

Additional Resources:

NCBI RefSeq record:
XM_017321343.1
NBCI Gene record:
Plcz1 (114875)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423266 GTTCCGAAACTTCCAATATTC pLKO_005 1385 CDS 100% 13.200 18.480 N Plcz1 n/a
2 TRCN0000097171 GCAATAAACAAGTATGCCTTT pLKO.1 909 CDS 100% 4.050 5.670 N Plcz1 n/a
3 TRCN0000434357 AGAGTCTATCAGCAATTTAAT pLKO_005 1407 CDS 100% 15.000 12.000 N Plcz1 n/a
4 TRCN0000417947 AGAGCCATTTACCGGTGTATT pLKO_005 399 5UTR 100% 13.200 10.560 N Plcz1 n/a
5 TRCN0000414837 ATTGAAGGTTTCGCAAGATAC pLKO_005 609 CDS 100% 10.800 8.640 N Plcz1 n/a
6 TRCN0000097169 CCCTCGACATTGAGTGGAATA pLKO.1 1284 CDS 100% 10.800 8.640 N Plcz1 n/a
7 TRCN0000097173 CCTTATCTGATCTTGTCATTT pLKO.1 1348 CDS 100% 13.200 9.240 N Plcz1 n/a
8 TRCN0000097170 CCAAGATATGAATCATCCATT pLKO.1 680 CDS 100% 4.950 3.465 N Plcz1 n/a
9 TRCN0000097172 CCAGTTCTTTGCATGAACAAA pLKO.1 2028 CDS 100% 5.625 3.375 N Plcz1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.