Transcript: Human XR_934628.2

PREDICTED: Homo sapiens mannose receptor C type 2 (MRC2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRC2 (9902)
Length:
4350
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934628.2
NBCI Gene record:
MRC2 (9902)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437330 GGATCGGCCTCAACGATTTGA pLKO_005 1455 3UTR 100% 5.625 7.875 N MRC2 n/a
2 TRCN0000029676 CCGGTATTGCTATAAGGTGTT pLKO.1 2170 3UTR 100% 4.050 3.240 N MRC2 n/a
3 TRCN0000417001 GGGTTCTCTTACCACAATTTC pLKO_005 2429 3UTR 100% 13.200 9.240 N MRC2 n/a
4 TRCN0000421716 CAACAAGATCTTCGGTGAATC pLKO_005 2314 3UTR 100% 10.800 7.560 N MRC2 n/a
5 TRCN0000437854 CACGAGCAGACCTACATCAAC pLKO_005 971 3UTR 100% 4.950 3.465 N MRC2 n/a
6 TRCN0000029674 CACTGAATCTTCGCTGGCATT pLKO.1 480 3UTR 100% 4.050 2.835 N MRC2 n/a
7 TRCN0000029677 CCCAATGTGACCTTTGACCTT pLKO.1 3215 3UTR 100% 2.640 1.848 N MRC2 n/a
8 TRCN0000029678 CCAGGGAAACTCCCACGGAAA pLKO.1 667 3UTR 100% 1.350 0.945 N MRC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.