Vector: pLKO.1

View complete vector list

Note: Vector maps may be generated using Vector NTI, which is no longer free, or with the free and easy-to-use plasmid editor ApE.

Vector Information:

Vector Name:
pLKO.1
Alias:
pLKO_TRC001
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
1.9 KB Stuffer
Selection Marker:
PuroR
Visible Reporter:
n/a
Cloning Site:
1.9 KB Stuffer
Sequence Data:
GB, FASTA

Control Clones

Clone ID Target Seq Target Gene ID Target Gene Symbol Taxon Target Region Notes
1 TRCN0000207152 AGTTCGTGACCGCCGCCGGGA GFP GFP CONTROL CDS N/A
2 TRCN0000072201 GTCGAGCTGGACGGCGACGTA GFP GFP CONTROL CDS N/A
3 TRCN0000207114 TCCGCCCTGAGCAAAGACCCC GFP GFP CONTROL CDS N/A
4 TRCN0000206973 GCACGACTTCTTCAAGTCCGC GFP GFP CONTROL CDS N/A
5 TRCN0000207020 GACCACCCTGACCTACGGCGT GFP GFP CONTROL CDS N/A
6 TRCN0000207257 GCTGTTCACCGGGGTGGTGCC GFP GFP CONTROL CDS N/A
7 TRCN0000072178 CAACAGCCACAACGTCTATAT GFP GFP CONTROL CDS N/A
8 TRCN0000072188 CCCGACCACATGAAGCAGCAC GFP GFP CONTROL CDS N/A
9 TRCN0000072183 CGGCATGGACGAGCTGTACAA GFP GFP CONTROL CDS N/A
10 TRCN0000072182 TCTCGGCATGGACGAGCTGTA GFP GFP CONTROL CDS N/A
11 TRCN0000072187 CTCTCGGCATGGACGAGCTGT GFP GFP CONTROL CDS N/A
12 TRCN0000072184 CGGGATCACTCTCGGCATGGA GFP GFP CONTROL CDS N/A
13 TRCN0000072198 GCGCGATCACATGGTCCTGCT GFP GFP CONTROL CDS N/A
14 TRCN0000072186 TGCCCGACAACCACTACCTGA GFP GFP CONTROL CDS N/A
15 TRCN0000072202 GCCACAACATCGAGGACGGCA GFP GFP CONTROL CDS N/A
16 TRCN0000072192 GAACGGCATCAAGGTGAACTT GFP GFP CONTROL CDS N/A
17 TRCN0000072180 CTATATCATGGCCGACAAGCA GFP GFP CONTROL CDS N/A
18 TRCN0000072196 ACGTCTATATCATGGCCGACA GFP GFP CONTROL CDS N/A
19 TRCN0000072181 ACAACAGCCACAACGTCTATA GFP GFP CONTROL CDS N/A
20 TRCN0000072185 TACAACAGCCACAACGTCTAT GFP GFP CONTROL CDS N/A
21 TRCN0000072200 AGTACAACTACAACAGCCACA GFP GFP CONTROL CDS N/A
22 TRCN0000072194 CCACATGAAGCAGCACGACTT GFP GFP CONTROL CDS N/A
23 TRCN0000072190 GACCACATGAAGCAGCACGAC GFP GFP CONTROL CDS N/A
24 TRCN0000072179 CGACCACATGAAGCAGCACGA GFP GFP CONTROL CDS N/A
25 TRCN0000072189 CCTACGGCGTGCAGTGCTTCA GFP GFP CONTROL CDS N/A
26 TRCN0000072199 TGACCCTGAAGTTCATCTGCA GFP GFP CONTROL CDS N/A
27 TRCN0000072197 CTACGGCAAGCTGACCCTGAA GFP GFP CONTROL CDS N/A
28 TRCN0000072193 CGACGTAAACGGCCACAAGTT GFP GFP CONTROL CDS N/A
29 TRCN0000072195 GCGACGTAAACGGCCACAAGT GFP GFP CONTROL CDS N/A
30 TRCN0000207065 GCGATCACATGGTCCTGCTGG GFP GFP CONTROL CDS N/A
31 TRCN0000072266 GAATGTTTACTACACTCGGAT LUCIFERASE LUCIFERASE CONTROL CDS N/A
32 TRCN0000072262 CACTTACGCTGAGTACTTCGA LUCIFERASE LUCIFERASE CONTROL CDS N/A
33 TRCN0000072263 AGTACTTCGAAATGTCCGTTC LUCIFERASE LUCIFERASE CONTROL CDS N/A
34 TRCN0000072259 CGCTGAGTACTTCGAAATGTC LUCIFERASE LUCIFERASE CONTROL CDS N/A
35 TRCN0000072267 GCGCCATTCTATCCGCTGGAA LUCIFERASE LUCIFERASE CONTROL CDS N/A
36 TRCN0000072265 GTTGTGTTTGTGGACGAAGTA LUCIFERASE LUCIFERASE CONTROL CDS N/A
37 TRCN0000072248 AGTCAAGTAACAACCGCGAAA LUCIFERASE LUCIFERASE CONTROL CDS N/A
38 TRCN0000072258 TGTCCGGTTATGTAAACAATC LUCIFERASE LUCIFERASE CONTROL CDS N/A
39 TRCN0000072249 GCGGTTGCCAAGAGGTTCCAT LUCIFERASE LUCIFERASE CONTROL CDS N/A
40 TRCN0000072261 CACTCGGATATTTGATATGTG LUCIFERASE LUCIFERASE CONTROL CDS N/A
41 TRCN0000072253 ACACTCGGATATTTGATATGT LUCIFERASE LUCIFERASE CONTROL CDS N/A
42 TRCN0000072254 ATGTTTACTACACTCGGATAT LUCIFERASE LUCIFERASE CONTROL CDS N/A
43 TRCN0000072255 TCTACTGGTCTGCCTAAAGGT LUCIFERASE LUCIFERASE CONTROL CDS N/A
44 TRCN0000072247 GAATCGTCGTATGCAGTGAAA LUCIFERASE LUCIFERASE CONTROL CDS N/A
45 TRCN0000072250 AGAATCGTCGTATGCAGTGAA LUCIFERASE LUCIFERASE CONTROL CDS N/A
46 TRCN0000072245 TCACAGAATCGTCGTATGCAG LUCIFERASE LUCIFERASE CONTROL CDS N/A
47 TRCN0000072244 ATCACAGAATCGTCGTATGCA LUCIFERASE LUCIFERASE CONTROL CDS N/A
48 TRCN0000072246 CAAATCACAGAATCGTCGTAT LUCIFERASE LUCIFERASE CONTROL CDS N/A
49 TRCN0000072243 CTTCGAAATGTCCGTTCGGTT LUCIFERASE LUCIFERASE CONTROL CDS N/A
50 TRCN0000072251 GAGTACTTCGAAATGTCCGTT LUCIFERASE LUCIFERASE CONTROL CDS N/A
51 TRCN0000072257 TGAGTACTTCGAAATGTCCGT LUCIFERASE LUCIFERASE CONTROL CDS N/A
52 TRCN0000072264 GCTGAGTACTTCGAAATGTCC LUCIFERASE LUCIFERASE CONTROL CDS N/A
53 TRCN0000072256 ACGCTGAGTACTTCGAAATGT LUCIFERASE LUCIFERASE CONTROL CDS N/A
54 TRCN0000072252 ACTTACGCTGAGTACTTCGAA LUCIFERASE LUCIFERASE CONTROL CDS N/A
55 TRCN0000072260 CAGAATCGTCGTATGCAGTGA LUCIFERASE LUCIFERASE CONTROL CDS N/A
56 TRCN0000072211 CTACACCATCGTGGAACAGTA RFP RFP CONTROL CDS N/A
57 TRCN0000072204 TCAGTTCCAGTACGGCTCCAA RFP RFP CONTROL CDS N/A
58 TRCN0000072217 CAACGAGGACTACACCATCGT RFP RFP CONTROL CDS N/A
59 TRCN0000072219 CTACAAGACCGACATCAAGCT RFP RFP CONTROL CDS N/A
60 TRCN0000072221 TGCAGAAGAAGACCATGGGCT RFP RFP CONTROL CDS N/A
61 TRCN0000072215 GTAATGCAGAAGAAGACCATG RFP RFP CONTROL CDS N/A
62 TRCN0000072210 CGTAATGCAGAAGAAGACCAT RFP RFP CONTROL CDS N/A
63 TRCN0000072212 CCGTAATGCAGAAGAAGACCA RFP RFP CONTROL CDS N/A
64 TRCN0000072206 GTGGGAGCGCGTGATGAACTT RFP RFP CONTROL CDS N/A
65 TRCN0000072208 GCTTCAAGTGGGAGCGCGTGA RFP RFP CONTROL CDS N/A
66 TRCN0000072209 CTCAGTTCCAGTACGGCTCCA RFP RFP CONTROL CDS N/A
67 TRCN0000072218 GAACGGCCACGAGTTCGAGAT RFP RFP CONTROL CDS N/A
68 TRCN0000072205 GCTCCGTGAACGGCCACGAGT RFP RFP CONTROL CDS N/A
69 TRCN0000072216 CCACTACGACGCCGAGGTCAA RFP RFP CONTROL CDS N/A
70 TRCN0000072203 CGCGTGATGAACTTCGAGGAC RFP RFP CONTROL CDS N/A
71 TRCN0000072213 ACTACACCATCGTGGAACAGT RFP RFP CONTROL CDS N/A
72 TRCN0000072230 CCCGTCAGTATCGGCGGAATT lacZ lacZ CONTROL CDS N/A
73 TRCN0000072234 CGGATTCTCTGGCCGTCGTAT lacZ lacZ CONTROL CDS N/A
74 TRCN0000072225 CTCTGGCTAACGGTACGCGTA lacZ lacZ CONTROL CDS N/A
75 TRCN0000072228 ACTCTGGCTAACGGTACGCGT lacZ lacZ CONTROL CDS N/A
76 TRCN0000072235 CCGTCATAGCGATAACGAGTT lacZ lacZ CONTROL CDS N/A
77 TRCN0000072238 GTTCCGTCATAGCGATAACGA lacZ lacZ CONTROL CDS N/A
78 TRCN0000072242 GTCGGCTTACGGCGGTGATTT lacZ lacZ CONTROL CDS N/A
79 TRCN0000072231 CGCTAAATACTGGCAGGCGTT lacZ lacZ CONTROL CDS N/A
80 TRCN0000072227 GCGCTAATCACGACGCGCTGT lacZ lacZ CONTROL CDS N/A
81 TRCN0000072226 CGATCGTAATCACCCGAGTGT lacZ lacZ CONTROL CDS N/A
82 TRCN0000072229 GCGATCGTAATCACCCGAGTG lacZ lacZ CONTROL CDS N/A
83 TRCN0000072224 CGCGATCGTAATCACCCGAGT lacZ lacZ CONTROL CDS N/A
84 TRCN0000072223 TGTTCGCATTATCCGAACCAT lacZ lacZ CONTROL CDS N/A
85 TRCN0000072237 CGCGCCTTTCGGCGGTGAAAT lacZ lacZ CONTROL CDS N/A
86 TRCN0000072233 CGACCACGCAAATCAGCGATT lacZ lacZ CONTROL CDS N/A
87 TRCN0000072236 CCAACGTGACCTATCCCATTA lacZ lacZ CONTROL CDS N/A
88 TRCN0000072240 TCGTATTACAACGTCGTGACT lacZ lacZ CONTROL CDS N/A
89 TRCN0000072232 CGTCGTATTACAACGTCGTGA lacZ lacZ CONTROL CDS N/A
90 TRCN0000072239 GCCGTCGTATTACAACGTCGT lacZ lacZ CONTROL CDS N/A
91 TRCN0000072241 GCGTTGGCAATTTAACCGCCA lacZ lacZ CONTROL CDS N/A
92 TRCN0000222866 GGACAGCCACATGCACTTCAA tGFP tGFP CONTROL CDS N/A
93 TRCN0000222796 TCCGTGGTGGACAGCCACATG tGFP tGFP CONTROL CDS N/A
94 TRCN0000222819 CGGCTACTACAGCTCCGTGGT tGFP tGFP CONTROL CDS N/A
95 TRCN0000223035 GCGTGATCTTCACCGACAAGA tGFP tGFP CONTROL CDS N/A
96 TRCN0000222803 ACCTGCTGAGCCACGTGATGG tGFP tGFP CONTROL CDS N/A
97 TRCN0000222901 ACCGACAAGATCATCCGCAGC tGFP tGFP CONTROL CDS N/A
98 TRCN0000222885 GCCACGTGATGGGCTACGGCT tGFP tGFP CONTROL CDS N/A
99 TRCN0000204879 (no hairpin) N/A N/A N/A N/A
100 TRCN0000208001 (no hairpin) N/A N/A N/A N/A
101 TRCN0000241922 (no hairpin) N/A N/A N/A N/A
Download CSV