Vector: pLKO.1

View complete vector list

Note: Vector maps may be generated using Vector NTI, which is no longer free, or with the free and easy-to-use plasmid editor ApE.

Vector Information:

Vector Name:
pLKO.1
Alias:
pLKO_TRC001
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
1.9 KB Stuffer
Selection Marker:
PuroR
Visible Reporter:
n/a
Cloning Site:
1.9 KB Stuffer
Sequence Data:
GB, FASTA

Control Clones

Clone ID Target Seq Target Gene ID Target Gene Symbol Taxon Target Region Notes
1 TRCN0000207114 TCCGCCCTGAGCAAAGACCCC GFP GFP CONTROL CDS
2 TRCN0000072198 GCGCGATCACATGGTCCTGCT GFP GFP CONTROL CDS
3 TRCN0000206973 GCACGACTTCTTCAAGTCCGC GFP GFP CONTROL CDS
4 TRCN0000072194 CCACATGAAGCAGCACGACTT GFP GFP CONTROL CDS
5 TRCN0000072190 GACCACATGAAGCAGCACGAC GFP GFP CONTROL CDS
6 TRCN0000072179 CGACCACATGAAGCAGCACGA GFP GFP CONTROL CDS
7 TRCN0000072189 CCTACGGCGTGCAGTGCTTCA GFP GFP CONTROL CDS
8 TRCN0000207020 GACCACCCTGACCTACGGCGT GFP GFP CONTROL CDS
9 TRCN0000072199 TGACCCTGAAGTTCATCTGCA GFP GFP CONTROL CDS
10 TRCN0000072197 CTACGGCAAGCTGACCCTGAA GFP GFP CONTROL CDS
11 TRCN0000072193 CGACGTAAACGGCCACAAGTT GFP GFP CONTROL CDS
12 TRCN0000072195 GCGACGTAAACGGCCACAAGT GFP GFP CONTROL CDS
13 TRCN0000072201 GTCGAGCTGGACGGCGACGTA GFP GFP CONTROL CDS
14 TRCN0000207257 GCTGTTCACCGGGGTGGTGCC GFP GFP CONTROL CDS
15 TRCN0000072186 TGCCCGACAACCACTACCTGA GFP GFP CONTROL CDS
16 TRCN0000072202 GCCACAACATCGAGGACGGCA GFP GFP CONTROL CDS
17 TRCN0000072192 GAACGGCATCAAGGTGAACTT GFP GFP CONTROL CDS
18 TRCN0000072180 CTATATCATGGCCGACAAGCA GFP GFP CONTROL CDS
19 TRCN0000072196 ACGTCTATATCATGGCCGACA GFP GFP CONTROL CDS
20 TRCN0000072181 ACAACAGCCACAACGTCTATA GFP GFP CONTROL CDS
21 TRCN0000072185 TACAACAGCCACAACGTCTAT GFP GFP CONTROL CDS
22 TRCN0000072200 AGTACAACTACAACAGCCACA GFP GFP CONTROL CDS
23 TRCN0000072178 CAACAGCCACAACGTCTATAT GFP GFP CONTROL CDS
24 TRCN0000072188 CCCGACCACATGAAGCAGCAC GFP GFP CONTROL CDS
25 TRCN0000072183 CGGCATGGACGAGCTGTACAA GFP GFP CONTROL CDS
26 TRCN0000072182 TCTCGGCATGGACGAGCTGTA GFP GFP CONTROL CDS
27 TRCN0000207065 GCGATCACATGGTCCTGCTGG GFP GFP CONTROL CDS
28 TRCN0000207152 AGTTCGTGACCGCCGCCGGGA GFP GFP CONTROL CDS
29 TRCN0000072184 CGGGATCACTCTCGGCATGGA GFP GFP CONTROL CDS
30 TRCN0000072187 CTCTCGGCATGGACGAGCTGT GFP GFP CONTROL CDS
31 TRCN0000072264 GCTGAGTACTTCGAAATGTCC LUCIFERASE LUCIFERASE CONTROL CDS
32 TRCN0000072244 ATCACAGAATCGTCGTATGCA LUCIFERASE LUCIFERASE CONTROL CDS
33 TRCN0000072252 ACTTACGCTGAGTACTTCGAA LUCIFERASE LUCIFERASE CONTROL CDS
34 TRCN0000072262 CACTTACGCTGAGTACTTCGA LUCIFERASE LUCIFERASE CONTROL CDS
35 TRCN0000072266 GAATGTTTACTACACTCGGAT LUCIFERASE LUCIFERASE CONTROL CDS
36 TRCN0000072260 CAGAATCGTCGTATGCAGTGA LUCIFERASE LUCIFERASE CONTROL CDS
37 TRCN0000072263 AGTACTTCGAAATGTCCGTTC LUCIFERASE LUCIFERASE CONTROL CDS
38 TRCN0000072259 CGCTGAGTACTTCGAAATGTC LUCIFERASE LUCIFERASE CONTROL CDS
39 TRCN0000072267 GCGCCATTCTATCCGCTGGAA LUCIFERASE LUCIFERASE CONTROL CDS
40 TRCN0000072265 GTTGTGTTTGTGGACGAAGTA LUCIFERASE LUCIFERASE CONTROL CDS
41 TRCN0000072248 AGTCAAGTAACAACCGCGAAA LUCIFERASE LUCIFERASE CONTROL CDS
42 TRCN0000072258 TGTCCGGTTATGTAAACAATC LUCIFERASE LUCIFERASE CONTROL CDS
43 TRCN0000072249 GCGGTTGCCAAGAGGTTCCAT LUCIFERASE LUCIFERASE CONTROL CDS
44 TRCN0000072261 CACTCGGATATTTGATATGTG LUCIFERASE LUCIFERASE CONTROL CDS
45 TRCN0000072253 ACACTCGGATATTTGATATGT LUCIFERASE LUCIFERASE CONTROL CDS
46 TRCN0000072254 ATGTTTACTACACTCGGATAT LUCIFERASE LUCIFERASE CONTROL CDS
47 TRCN0000072255 TCTACTGGTCTGCCTAAAGGT LUCIFERASE LUCIFERASE CONTROL CDS
48 TRCN0000072247 GAATCGTCGTATGCAGTGAAA LUCIFERASE LUCIFERASE CONTROL CDS
49 TRCN0000072250 AGAATCGTCGTATGCAGTGAA LUCIFERASE LUCIFERASE CONTROL CDS
50 TRCN0000072245 TCACAGAATCGTCGTATGCAG LUCIFERASE LUCIFERASE CONTROL CDS
51 TRCN0000072246 CAAATCACAGAATCGTCGTAT LUCIFERASE LUCIFERASE CONTROL CDS
52 TRCN0000072243 CTTCGAAATGTCCGTTCGGTT LUCIFERASE LUCIFERASE CONTROL CDS
53 TRCN0000072251 GAGTACTTCGAAATGTCCGTT LUCIFERASE LUCIFERASE CONTROL CDS
54 TRCN0000072257 TGAGTACTTCGAAATGTCCGT LUCIFERASE LUCIFERASE CONTROL CDS
55 TRCN0000072256 ACGCTGAGTACTTCGAAATGT LUCIFERASE LUCIFERASE CONTROL CDS
56 TRCN0000072205 GCTCCGTGAACGGCCACGAGT RFP RFP CONTROL CDS
57 TRCN0000072218 GAACGGCCACGAGTTCGAGAT RFP RFP CONTROL CDS
58 TRCN0000072209 CTCAGTTCCAGTACGGCTCCA RFP RFP CONTROL CDS
59 TRCN0000072208 GCTTCAAGTGGGAGCGCGTGA RFP RFP CONTROL CDS
60 TRCN0000072206 GTGGGAGCGCGTGATGAACTT RFP RFP CONTROL CDS
61 TRCN0000072212 CCGTAATGCAGAAGAAGACCA RFP RFP CONTROL CDS
62 TRCN0000072210 CGTAATGCAGAAGAAGACCAT RFP RFP CONTROL CDS
63 TRCN0000072215 GTAATGCAGAAGAAGACCATG RFP RFP CONTROL CDS
64 TRCN0000072221 TGCAGAAGAAGACCATGGGCT RFP RFP CONTROL CDS
65 TRCN0000072219 CTACAAGACCGACATCAAGCT RFP RFP CONTROL CDS
66 TRCN0000072217 CAACGAGGACTACACCATCGT RFP RFP CONTROL CDS
67 TRCN0000072213 ACTACACCATCGTGGAACAGT RFP RFP CONTROL CDS
68 TRCN0000072211 CTACACCATCGTGGAACAGTA RFP RFP CONTROL CDS
69 TRCN0000072204 TCAGTTCCAGTACGGCTCCAA RFP RFP CONTROL CDS
70 TRCN0000072203 CGCGTGATGAACTTCGAGGAC RFP RFP CONTROL CDS
71 TRCN0000072216 CCACTACGACGCCGAGGTCAA RFP RFP CONTROL CDS
72 TRCN0000072223 TGTTCGCATTATCCGAACCAT lacZ lacZ CONTROL CDS
73 TRCN0000072239 GCCGTCGTATTACAACGTCGT lacZ lacZ CONTROL CDS
74 TRCN0000072233 CGACCACGCAAATCAGCGATT lacZ lacZ CONTROL CDS
75 TRCN0000072236 CCAACGTGACCTATCCCATTA lacZ lacZ CONTROL CDS
76 TRCN0000072240 TCGTATTACAACGTCGTGACT lacZ lacZ CONTROL CDS
77 TRCN0000072232 CGTCGTATTACAACGTCGTGA lacZ lacZ CONTROL CDS
78 TRCN0000072224 CGCGATCGTAATCACCCGAGT lacZ lacZ CONTROL CDS
79 TRCN0000072229 GCGATCGTAATCACCCGAGTG lacZ lacZ CONTROL CDS
80 TRCN0000072226 CGATCGTAATCACCCGAGTGT lacZ lacZ CONTROL CDS
81 TRCN0000072227 GCGCTAATCACGACGCGCTGT lacZ lacZ CONTROL CDS
82 TRCN0000072231 CGCTAAATACTGGCAGGCGTT lacZ lacZ CONTROL CDS
83 TRCN0000072242 GTCGGCTTACGGCGGTGATTT lacZ lacZ CONTROL CDS
84 TRCN0000072238 GTTCCGTCATAGCGATAACGA lacZ lacZ CONTROL CDS
85 TRCN0000072235 CCGTCATAGCGATAACGAGTT lacZ lacZ CONTROL CDS
86 TRCN0000072228 ACTCTGGCTAACGGTACGCGT lacZ lacZ CONTROL CDS
87 TRCN0000072225 CTCTGGCTAACGGTACGCGTA lacZ lacZ CONTROL CDS
88 TRCN0000072241 GCGTTGGCAATTTAACCGCCA lacZ lacZ CONTROL CDS
89 TRCN0000072230 CCCGTCAGTATCGGCGGAATT lacZ lacZ CONTROL CDS
90 TRCN0000072234 CGGATTCTCTGGCCGTCGTAT lacZ lacZ CONTROL CDS
91 TRCN0000072237 CGCGCCTTTCGGCGGTGAAAT lacZ lacZ CONTROL CDS
92 TRCN0000222866 GGACAGCCACATGCACTTCAA tGFP tGFP CONTROL CDS
93 TRCN0000222796 TCCGTGGTGGACAGCCACATG tGFP tGFP CONTROL CDS
94 TRCN0000222819 CGGCTACTACAGCTCCGTGGT tGFP tGFP CONTROL CDS
95 TRCN0000223035 GCGTGATCTTCACCGACAAGA tGFP tGFP CONTROL CDS
96 TRCN0000222803 ACCTGCTGAGCCACGTGATGG tGFP tGFP CONTROL CDS
97 TRCN0000222885 GCCACGTGATGGGCTACGGCT tGFP tGFP CONTROL CDS
98 TRCN0000222901 ACCGACAAGATCATCCGCAGC tGFP tGFP CONTROL CDS
99 TRCN0000208001 (no hairpin) N/A N/A N/A
100 TRCN0000241922 (no hairpin) N/A N/A N/A
101 TRCN0000204879 (no hairpin) N/A N/A N/A
Download CSV