Annotation Summary for Cell Line: NCI-H23  

Cell line primary name: NCI-H23
Cell line aliases: H23
Gender: M
Site Primary: lung
Histology: carcinoma
Hist Subtype1: non_small_cell_carcinoma
Notes:
Source: ATCC
Expression arrays: MAKER_p_NCLE_RNA7_HG-U133_Plus_2_D08_454648
SNP arrays: PODIA_p_NCLE_DNAAffy7_GenomeWideSNP_6_E03_437410
Oncomap: yes
Hybrid Capture Sequencing: yes


Mutations in NCI-H23

GeneProtein
Change
ChrStartEnd SampleNCBI
Build
Variant
Classification
Variant TypeReference
Allele
Tumor
Allele 1
dbSNP IDAnnotation
Transcript
Other
Transcripts
Method View
Reads
Mutation
Assessor
AAK1 p.541_542QQ>Q 2 69741754 69741756 NCIH23_LUNG 37 In_Frame_Del Del TGT - rs55712143 uc002sfp.2 AAK1_uc010fdk.2... Hybrid_Cap...
ACACA p.K235I 17 35634805 35634805 NCIH23_LUNG 37 Missense_Mutation SNP T A uc002hno.2 ACACA_uc002hnk.... Hybrid_Cap... view
ACACA 17 35766564 35766564 NCIH23_LUNG 37 5'UTR Del A - uc002hno.2 ACACA_uc002hnn.... Hybrid_Cap...
ACACB p.307_308NA>KP 12 109605835 109605836 NCIH23_LUNG 37 Missense_Mutation DNP CG AC rs78715638 uc001tob.2 ACACB_uc001toc.... Hybrid_Cap...
ACACB p.D1736N 12 109683458 109683458 NCIH23_LUNG 37 Missense_Mutation SNP G A uc001tob.2 ACACB_uc001toc.... Hybrid_Cap... view
ACSL6 p.G503_splice 5 131305820 131305820 NCIH23_LUNG 37 Splice_Site_SNP SNP C A uc003kvx.1 ACSL6_uc003kvv.... Hybrid_Cap... view
ADAM17 2 9630245 9630245 NCIH23_LUNG 37 3'UTR Del T - uc002qzu.2 IAH1_uc010yiz.1... Hybrid_Cap...
ADAM17 p.H336L 2 9658327 9658327 NCIH23_LUNG 37 Missense_Mutation SNP T A uc002qzu.2 ADAM17_uc010ewy... Hybrid_Cap... view
ADAM28 8 24211994 24211997 NCIH23_LUNG 37 3'UTR Del CTAT - rs10610134 uc003xdy.2 ADAM28_uc011laa... Hybrid_Cap...
ADAMTS20 p.E558* 12 43847798 43847798 NCIH23_LUNG 37 Nonsense_Mutation SNP C A uc010skx.1 Hybrid_Cap... view
ADCK1 14 78390632 78390637 NCIH23_LUNG 37 Intron Del AAACT... - rs78274857;rs74969652 uc001xui.2 ADCK1_uc010tvo.... Hybrid_Cap...
AKAP12 p.G269del 6 151670330 151670332 NCIH23_LUNG 37 In_Frame_Del Del AGG - rs111963593;rs111653642 uc011eep.1 AKAP12_uc003qoe... Hybrid_Cap...
AKAP12 p.Q864L 6 151672117 151672117 NCIH23_LUNG 37 Missense_Mutation SNP A T uc011eep.1 AKAP12_uc003qoe... Hybrid_Cap... view
AKAP12 p.1531_1532insE 6 151674116 151674117 NCIH23_LUNG 37 In_Frame_Ins Ins - GAG rs34737819 uc011eep.1 AKAP12_uc003qoe... Hybrid_Cap...
AKAP12 p.E1536Q 6 151674132 151674132 NCIH23_LUNG 37 Missense_Mutation SNP G C uc011eep.1 AKAP12_uc003qoe... Hybrid_Cap... view
AKAP12 p.D1586N 6 151674282 151674282 NCIH23_LUNG 37 Missense_Mutation SNP G A uc011eep.1 AKAP12_uc003qoe... Hybrid_Cap... view
AKAP12 p.D1698H 6 151674618 151674618 NCIH23_LUNG 37 Missense_Mutation SNP G C uc011eep.1 AKAP12_uc003qoe... Hybrid_Cap... view
ATM p.Q1919P 11 108178705 108178705 NCIH23_LUNG 37 Missense_Mutation SNP A C uc001pkb.1 ATM_uc009yxr.1_... Hybrid_Cap... view
BCL3 19 45262965 45262967 NCIH23_LUNG 37 3'UTR Del CCC - uc010xxe.1 Hybrid_Cap...
BCR p.R567H 22 23603675 23603675 NCIH23_LUNG 37 Missense_Mutation SNP G A uc002zww.2 BCR_uc002zwx.2_... Hybrid_Cap... view
BCR 22 23631813 23631814 NCIH23_LUNG 37 Intron Ins - C rs66503844 uc002zww.2 BCR_uc002zwx.2_... Hybrid_Cap...
BCR 22 23631881 23631882 NCIH23_LUNG 37 Intron Ins - T uc002zww.2 BCR_uc002zwx.2_... Hybrid_Cap...
BMI1 p.I152F 10 22615403 22615403 NCIH23_LUNG 37 Missense_Mutation SNP A T uc009xkg.2 BMI1_uc001irh.2... Hybrid_Cap... view
BMPR1B p.W474C 4 96075737 96075737 NCIH23_LUNG 37 Missense_Mutation SNP G T uc003htm.3 BMPR1B_uc010ilb... Hybrid_Cap... view
BRIP1 p.E1054A 17 59761246 59761246 NCIH23_LUNG 37 Missense_Mutation SNP T G uc002izk.1 Hybrid_Cap... view
BTK X 100611036 100611036 NCIH23_LUNG 37 Intron SNP C G uc010nno.2 BTK_uc004ehf.2_... Hybrid_Cap... view
BTRC p.R605K 10 103310613 103310613 NCIH23_LUNG 37 Missense_Mutation SNP G A uc001kta.2 BTRC_uc001ktb.2... Hybrid_Cap... view
C17ORF37 17 37885640 37885641 NCIH23_LUNG 37 3'UTR Ins - G rs75811535 uc002hsq.2 Hybrid_Cap...
CACNB2 10 18689934 18689934 NCIH23_LUNG 37 Intron SNP G A uc001ipr.2 CACNB2_uc009xjz... Hybrid_Cap... view
CACNB2 p.P176T 10 18789810 18789810 NCIH23_LUNG 37 Missense_Mutation SNP C A uc001ipr.2 CACNB2_uc009xjz... Hybrid_Cap... view
CACNB2 10 18828721 18828722 NCIH23_LUNG 37 3'UTR Ins - AA rs3841459 uc001ipr.2 CACNB2_uc009xjz... Hybrid_Cap...
CATSPERB p.P866L 14 92076825 92076825 NCIH23_LUNG 37 Missense_Mutation SNP G A uc001xzs.1 CATSPERB_uc010a... Hybrid_Cap... view
CHD1 p.P1684del 5 98192165 98192167 NCIH23_LUNG 37 In_Frame_Del Del AGG - rs79267787;rs61749618 uc003knf.2 CHD1_uc010jbn.2... Hybrid_Cap...
CHIC2 4 54876132 54876132 NCIH23_LUNG 37 3'UTR Del C - rs4437313 uc003haj.1 PDGFRA_uc003haa... Hybrid_Cap...
CLTCL1 p.V1201_splice 22 19189003 19189004 NCIH23_LUNG 37 Splice_Site_Ins Ins - C rs11386977 uc002zpb.2 CLTCL1_uc011agv... Hybrid_Cap...
CNTN1 p.Q841K 12 41414240 41414240 NCIH23_LUNG 37 Missense_Mutation SNP C A uc001rmm.1 CNTN1_uc001rmn.... Hybrid_Cap... view
CNTN5 p.M295fs 11 99872771 99872772 NCIH23_LUNG 37 Frame_Shift_Ins Ins - T uc001pga.2 CNTN5_uc009ywv.... Hybrid_Cap...
CNTN6 3 1339681 1339686 NCIH23_LUNG 37 Intron Del GTTTT... - uc003boz.2 CNTN6_uc010hbo.... Hybrid_Cap...
COL3A1 p.G924C 2 189868816 189868816 NCIH23_LUNG 37 Missense_Mutation SNP G T uc002uqj.1 Hybrid_Cap... view
CREB3L2 p.T100del 7 137612914 137612916 NCIH23_LUNG 37 In_Frame_Del Del TGG - uc003vtw.2 CREB3L2_uc003vt... Hybrid_Cap...
CRKL p.L118R 22 21288108 21288108 NCIH23_LUNG 37 Missense_Mutation SNP T G uc002ztf.2 CRKL_uc002ztg.1... Hybrid_Cap... view
CSF1R p.P202S 5 149457800 149457800 NCIH23_LUNG 37 Missense_Mutation SNP G A uc003lrl.2 CSF1R_uc011dcd.... Hybrid_Cap... view
CSMD3 p.L2800I 8 113314064 113314064 NCIH23_LUNG 37 Missense_Mutation SNP G T uc003ynu.2 CSMD3_uc003yns.... Hybrid_Cap... view
CXCR7 p.I253M 2 237489867 237489867 NCIH23_LUNG 37 Missense_Mutation SNP C G uc010fyq.2 CXCR7_uc002vwd.... Hybrid_Cap... view
DACH1 p.G376_splice 13 72147146 72147146 NCIH23_LUNG 37 Splice_Site_SNP SNP T G uc010thn.1 DACH1_uc010tho.... Hybrid_Cap... view
DAPK3 p.G338C 19 3959452 3959452 NCIH23_LUNG 37 Missense_Mutation SNP C A uc002lzc.1 DAPK3_uc002lzb.... Hybrid_Cap... view
DDR2 p.G101W 1 162724529 162724529 NCIH23_LUNG 37 Missense_Mutation SNP G T uc001gcf.2 DDR2_uc001gcg.2... Hybrid_Cap... view
DNAH8 p.K4423N 6 38997964 38997964 NCIH23_LUNG 37 Missense_Mutation SNP G T uc003ooe.1 Hybrid_Cap... view
DYRK1B p.K345N 19 40317985 40317985 NCIH23_LUNG 37 Missense_Mutation SNP C A uc002omj.2 DYRK1B_uc002omi... Hybrid_Cap... view
EDN1 6 12296150 12296151 NCIH23_LUNG 37 Intron Ins - T rs66570617 uc003nae.3 EDN1_uc003nad.2... Hybrid_Cap...
EHBP1 p.W72C 2 62991454 62991454 NCIH23_LUNG 37 Missense_Mutation SNP G T uc002sby.2 EHBP1_uc010fcp.... Hybrid_Cap... view
EIF4G1 p.E1302D 3 184045722 184045722 NCIH23_LUNG 37 Missense_Mutation SNP G T uc010hxx.2 EIF4G1_uc003fnp... Hybrid_Cap... view
EP300 22 41574970 41574972 NCIH23_LUNG 37 3'UTR Del GTA - rs76489032 uc003azl.3 Hybrid_Cap...
EPHA6 3 97367230 97367231 NCIH23_LUNG 37 Intron Ins - A rs115253553 uc010how.1 EPHA6_uc003drs.... Hybrid_Cap...
FANCI p.D1048Y 15 89848429 89848429 NCIH23_LUNG 37 Missense_Mutation SNP G T uc010bnp.1 FANCI_uc002bnm.... Hybrid_Cap... view
FBN1 p.R233L 15 48829846 48829846 NCIH23_LUNG 37 Missense_Mutation SNP C A uc001zwx.1 Hybrid_Cap... view
FGFR1OP 6 167453519 167453520 NCIH23_LUNG 37 3'UTR Ins - T rs115519488 uc003qvj.2 CCR6_uc003qvl.2... Hybrid_Cap...
FGFR2 10 123276934 123276934 NCIH23_LUNG 37 Intron SNP T G uc010qtj.1 FGFR2_uc010qtg.... Hybrid_Cap... view
FGFR3 4 1809128 1809129 NCIH23_LUNG 37 3'UTR Del GT - uc003gdu.2 FGFR3_uc003gdr.... Hybrid_Cap...
FLI1 11 128638217 128638217 NCIH23_LUNG 37 Intron Del G - uc010sbu.1 FLI1_uc010sbt.1... Hybrid_Cap...
FLT3 p.P738H 13 28599075 28599075 NCIH23_LUNG 37 Missense_Mutation SNP G T uc001urw.2 FLT3_uc010aao.2... Hybrid_Cap... view
FMN2 p.PPLPGAGIPPP939del 1 240370914 240370946 NCIH23_LUNG 37 In_Frame_Del Del GCCCC... - rs4997328;rs4997329 uc010pye.1 FMN2_uc010pyd.1... Hybrid_Cap...
FN1 p.T2107T 2 216237025 216237025 NCIH23_LUNG 37 Silent SNP T G uc002vfa.2 FN1_uc002vfb.2_... Hybrid_Cap... view
FN1 p.A1304A 2 216257811 216257811 NCIH23_LUNG 37 Silent SNP C T uc002vfa.2 FN1_uc002vfb.2_... Hybrid_Cap... view
FN1 p.G1189V 2 216261898 216261898 NCIH23_LUNG 37 Missense_Mutation SNP C A uc002vfa.2 FN1_uc002vfb.2_... Hybrid_Cap... view
FOS p.S364I 14 75748075 75748075 NCIH23_LUNG 37 Missense_Mutation SNP G T uc001xrn.2 FOS_uc010tva.1_... Hybrid_Cap... view
FSCB p.679_679P>PSEVQPPPAEEAP 14 44974154 44974155 NCIH23_LUNG 37 In_Frame_Ins Ins - GGGGCCTCCTCAGCTGGTGGAGGCTGAACTTCAGAG uc001wvn.2 Hybrid_Cap...
FZD1 p.93_94insP 7 90894459 90894460 NCIH23_LUNG 37 In_Frame_Ins Ins - CCG uc003ula.2 Hybrid_Cap...
FZD1 7 90896245 90896245 NCIH23_LUNG 37 3'UTR SNP T G uc003ula.2 Hybrid_Cap... view
GHR p.Q602K 5 42719413 42719413 NCIH23_LUNG 37 Missense_Mutation SNP C A uc003jmt.2 GHR_uc011cpq.1_... Hybrid_Cap... view
GLI3 p.P344L 7 42066009 42066009 NCIH23_LUNG 37 Missense_Mutation SNP G A uc011kbh.1 GLI3_uc011kbg.1... Hybrid_Cap... view
GMPS p.V613L 3 155654155 155654156 NCIH23_LUNG 37 Missense_Mutation DNP GG TT uc003faq.2 GMPS_uc011bom.1... Hybrid_Cap...
GPC3 p.V289L X 132887676 132887676 NCIH23_LUNG 37 Missense_Mutation SNP C A uc010nrn.1 GPC3_uc004exd.1... Hybrid_Cap... view
GPR112 p.D2657del X 135474445 135474447 NCIH23_LUNG 37 In_Frame_Del Del GAT - rs3030295 uc004ezu.1 GPR112_uc010nsb... Hybrid_Cap...
GRB2 17 73389713 73389713 NCIH23_LUNG 37 5'UTR SNP G A uc002jnx.3 GRB2_uc002jny.3... Hybrid_Cap... view
GRIA3 X 122318386 122318387 NCIH23_LUNG 37 Splice_Site_Ins Ins - G rs66632982 uc004etq.3 GRIA3_uc004etr.... Hybrid_Cap...
GRIN2B p.G1328fs 12 13716189 13716189 NCIH23_LUNG 37 Frame_Shift_Del Del C - uc001rbt.2 Hybrid_Cap...
GRK7 p.N121K 3 141497489 141497489 NCIH23_LUNG 37 Missense_Mutation SNP C A uc011bnd.1 Hybrid_Cap... view
GUCY2C 12 14827464 14827466 NCIH23_LUNG 37 Intron Del ATC - rs72525754;rs3083879 uc001rcd.2 GUCY2C_uc009zhz... Hybrid_Cap...
GUCY2F p.S115T X 108718823 108718823 NCIH23_LUNG 37 Missense_Mutation SNP A T uc004eod.3 GUCY2F_uc011msq... Hybrid_Cap... view
HEPH p.N591S X 65418769 65418769 NCIH23_LUNG 37 Missense_Mutation SNP A G uc011moz.1 HEPH_uc004dwn.2... Hybrid_Cap... view
HMMR p.R125W 5 162896746 162896746 NCIH23_LUNG 37 Missense_Mutation SNP A T uc003lzh.2 HMMR_uc003lzf.2... Hybrid_Cap... view
HSP90B1 p.E791del 12 104341188 104341190 NCIH23_LUNG 37 In_Frame_Del Del GAA - rs117491163 uc001tkb.1 HSP90B1_uc010sw... Hybrid_Cap...
IL21R 16 27460779 27460780 NCIH23_LUNG 37 3'UTR Ins - TGTG rs66690088 uc002doq.1 IL21R_uc002dor.... Hybrid_Cap...
ILK 11 6630029 6630029 NCIH23_LUNG 37 Intron Del C - uc001mee.2 ILK_uc001mef.2_... Hybrid_Cap...
ING1 p.A174S 13 111368310 111368310 NCIH23_LUNG 37 Missense_Mutation SNP G T uc001vri.2 CARS2_uc010tjm.... Hybrid_Cap... view
INPP4B p.E574_splice 4 143066992 143066992 NCIH23_LUNG 37 Splice_Site_SNP SNP C A uc003iix.3 INPP4B_uc003iiw... Hybrid_Cap... view
INPP5D p.P1058S 2 234112968 234112968 NCIH23_LUNG 37 Missense_Mutation SNP C T uc010zmo.1 INPP5D_uc010zmp... Hybrid_Cap... view
IRS1 p.R1152I 2 227659999 227660000 NCIH23_LUNG 37 Missense_Mutation DNP CC AA uc002voh.3 Hybrid_Cap...
IRS1 p.T311del 2 227662522 227662524 NCIH23_LUNG 37 In_Frame_Del Del GGT - uc002voh.3 Hybrid_Cap...
KALRN p.T2456S 3 124398354 124398354 NCIH23_LUNG 37 Missense_Mutation SNP C G uc003ehg.2 KALRN_uc003ehk.... Hybrid_Cap... view
KIAA0802 p.E176* 18 8783636 8783636 NCIH23_LUNG 37 Nonsense_Mutation SNP G T uc002knr.2 KIAA0802_uc002k... Hybrid_Cap... view
KIAA0802 p.E316K 18 8784056 8784056 NCIH23_LUNG 37 Missense_Mutation SNP G A uc002knr.2 KIAA0802_uc002k... Hybrid_Cap... view
KIAA1409 p.D1118N 14 94079205 94079205 NCIH23_LUNG 37 Missense_Mutation SNP G A uc001ybv.1 KIAA1409_uc001y... Hybrid_Cap... view
KLK7 19 51480672 51480675 NCIH23_LUNG 37 3'UTR Del GGTT - uc002puo.2 KLK7_uc002pup.2... Hybrid_Cap...
KRAS p.G12C 12 25398285 25398285 NCIH23_LUNG 37 Missense_Mutation SNP C A uc001rgp.1 KRAS_uc001rgq.1... Hybrid_Cap... view
LAMA1 p.R244Q 18 7049114 7049114 NCIH23_LUNG 37 Missense_Mutation SNP C T uc002knm.2 LAMA1_uc010wzj.... Hybrid_Cap... view
LAMA1 p.D1309Y 18 7009314 7009314 NCIH23_LUNG 37 Missense_Mutation SNP C A uc002knm.2 LAMA1_uc010wzj.... Hybrid_Cap... view
LRP1B p.R4084L 2 141083420 141083420 NCIH23_LUNG 37 Missense_Mutation SNP C A uc002tvj.1 Hybrid_Cap... view
LRP1B p.S1177T 2 141660726 141660726 NCIH23_LUNG 37 Missense_Mutation SNP A T uc002tvj.1 LRP1B_uc010fnl.... Hybrid_Cap... view
LRP2 p.P3734L 2 170028587 170028587 NCIH23_LUNG 37 Missense_Mutation SNP G A uc002ues.2 Hybrid_Cap... view
LRRC7 p.R754L 1 70503882 70503882 NCIH23_LUNG 37 Missense_Mutation SNP G T uc001dep.2 LRRC7_uc009wbg.... Hybrid_Cap... view
MAGEB16 X 35821297 35821297 NCIH23_LUNG 37 3'UTR SNP T A uc010ngt.1 Hybrid_Cap... view
MAMDC4 p.S299C 9 139749090 139749090 NCIH23_LUNG 37 Missense_Mutation SNP C G uc004cjs.2 MAMDC4_uc011mej... Hybrid_Cap... view
MAP3K1 p.T949del 5 56177849 56177851 NCIH23_LUNG 37 In_Frame_Del Del CAA - uc003jqw.3 Hybrid_Cap...
MAP3K14 p.R218_splice 17 43364293 43364294 NCIH23_LUNG 37 Splice_Site_Ins Ins - G rs66766023 uc002iiw.1 MAP3K14_uc010da... Hybrid_Cap...
MAP4K4 2 102507726 102507726 NCIH23_LUNG 37 3'UTR SNP A T uc002tbc.2 MAP4K4_uc002tbd... Hybrid_Cap... view
MAPK14 6 36076345 36076354 NCIH23_LUNG 37 3'UTR Del GTGTG... - rs80147786 uc003olp.2 MAPK14_uc003olq... Hybrid_Cap...
MAPK6 p.M225L 15 52342307 52342307 NCIH23_LUNG 37 Missense_Mutation SNP A T uc002abp.2 Hybrid_Cap... view
MARK1 p.G497C 1 220823980 220823980 NCIH23_LUNG 37 Missense_Mutation SNP G T uc009xdw.2 MARK1_uc001hmn.... Hybrid_Cap... view
MCM4 p.R98W 8 48874669 48874669 NCIH23_LUNG 37 Missense_Mutation SNP C T uc003xqk.1 PRKDC_uc003xqi.... Hybrid_Cap... view
MPPED2 p.R35I 11 30601817 30601817 NCIH23_LUNG 37 Missense_Mutation SNP C A uc001msr.2 MPPED2_uc001msq... Hybrid_Cap... view
MSH3 p.E251* 5 79966087 79966087 NCIH23_LUNG 37 Nonsense_Mutation SNP G T uc003kgz.2 Hybrid_Cap... view
MYCN 2 16086343 16086343 NCIH23_LUNG 37 3'UTR SNP C G uc002rci.2 MYCN_uc010yjr.1... Hybrid_Cap... view
MYD88 p.M40T 3 38180271 38180271 NCIH23_LUNG 37 Missense_Mutation SNP T C uc003chx.2 ACAA1_uc003cht.... Hybrid_Cap... view
MYH1 p.L537M 17 10411968 10411968 NCIH23_LUNG 37 Missense_Mutation SNP G T uc002gmo.2 Hybrid_Cap... view
MYLK p.E1066del 3 123419117 123419119 NCIH23_LUNG 37 In_Frame_Del Del TTC - rs72491150 uc003ego.2 MYLK_uc011bjw.1... Hybrid_Cap...
MYLK p.V278L 3 123453011 123453011 NCIH23_LUNG 37 Missense_Mutation SNP C A uc003ego.2 MYLK_uc011bjw.1... Hybrid_Cap... view
MYST4 p.E1104del 10 76781906 76781908 NCIH23_LUNG 37 In_Frame_Del Del GAA - rs79644703 uc001jwn.1 MYST4_uc001jwm.... Hybrid_Cap...
MYST4 p.G1134C 10 76784743 76784743 NCIH23_LUNG 37 Missense_Mutation SNP G T uc001jwn.1 MYST4_uc001jwo.... Hybrid_Cap... view
MYST4 10 76790936 76790936 NCIH23_LUNG 37 3'UTR Del A - uc001jwn.1 MYST4_uc001jwo.... Hybrid_Cap...
NCAM1 11 112832307 112832308 NCIH23_LUNG 37 5'UTR Ins - A rs117108942 uc009yyq.1 NCAM1_uc001pno.... Hybrid_Cap...
NCAM1 11 112832340 112832340 NCIH23_LUNG 37 5'UTR Del C - uc009yyq.1 NCAM1_uc001pno.... Hybrid_Cap...
NCKIPSD p.Q684L 3 48712095 48712095 NCIH23_LUNG 37 Missense_Mutation SNP T A uc003cun.2 CELSR3_uc003cuf... Hybrid_Cap... view
NCOA3 p.Q1276del 20 46279837 46279839 NCIH23_LUNG 37 In_Frame_Del Del CAG - rs2664555 uc002xtk.2 NCOA3_uc010ght.... Hybrid_Cap...
NEK3 p.K313_splice 13 52718050 52718051 NCIH23_LUNG 37 Splice_Site_Ins Ins - T rs72514762 uc001vgh.2 NEK3_uc001vgg.2... Hybrid_Cap...
NFIA 1 61921185 61921186 NCIH23_LUNG 37 3'UTR Ins - T rs57270124;rs76131997 uc010oos.1 NFIA_uc001czy.2... Hybrid_Cap...
NIN p.P1987S 14 51196360 51196360 NCIH23_LUNG 37 Missense_Mutation SNP G A uc001wyi.2 NIN_uc001wyj.2_... Hybrid_Cap... view
NLRP3 1 247612008 247612008 NCIH23_LUNG 37 3'UTR SNP C A uc001icr.2 NLRP3_uc001ics.... Hybrid_Cap... view
NOTCH1 p.T1883I 9 139395290 139395290 NCIH23_LUNG 37 Missense_Mutation SNP G A uc004chz.2 Hybrid_Cap... view
NOVA1 p.A283S 14 26917842 26917842 NCIH23_LUNG 37 Missense_Mutation SNP C A uc001wpy.2 NOVA1_uc001wpz.... Hybrid_Cap... view
NPR1 1 153665919 153665920 NCIH23_LUNG 37 3'UTR Ins - C rs66682713 uc001fcs.3 NPR1_uc010pdz.1... Hybrid_Cap...
NPRL2 3 50384978 50384978 NCIH23_LUNG 37 3'UTR Del C - rs75013672 uc003daj.1 ZMYND10_uc003da... Hybrid_Cap...
NR1H2 p.176_177insQ 19 50881822 50881823 NCIH23_LUNG 37 In_Frame_Ins Ins - CAG rs61751954;rs1052533 uc010enw.2 NR1H2_uc002prv.... Hybrid_Cap...
NR2F1 5 92929698 92929698 NCIH23_LUNG 37 3'UTR SNP C A uc003kkj.2 Hybrid_Cap... view
NTSR1 p.G220C 20 61341217 61341217 NCIH23_LUNG 37 Missense_Mutation SNP G T uc002ydf.2 Hybrid_Cap... view
NUAK1 p.E346* 12 106461530 106461530 NCIH23_LUNG 37 Nonsense_Mutation SNP C A uc001tlj.1 Hybrid_Cap... view
NUP214 9 134067556 134067557 NCIH23_LUNG 37 Intron Ins - T rs66652901 uc004cag.2 NUP214_uc004cah... Hybrid_Cap...
OR2L13 p.C178S 1 248263210 248263210 NCIH23_LUNG 37 Missense_Mutation SNP G C uc001ids.2 Hybrid_Cap... view
OSR1 p.H48D 2 19553425 19553425 NCIH23_LUNG 37 Missense_Mutation SNP G C uc002rdc.2 Hybrid_Cap... view
PAPPA p.C1600fs 9 119158809 119158809 NCIH23_LUNG 37 Frame_Shift_Del Del T - uc004bjn.2 PAPPA_uc011lxq.... Hybrid_Cap...
PASK p.S496G 2 242066844 242066844 NCIH23_LUNG 37 Missense_Mutation SNP T C uc010fzl.1 PASK_uc010zol.1... Hybrid_Cap... view
PAX3 2 223158653 223158653 NCIH23_LUNG 37 Intron Del T - rs112753212 uc002vmt.1 PAX3_uc002vmy.1... Hybrid_Cap...
PCDH15 p.K946N 10 55755454 55755454 NCIH23_LUNG 37 Missense_Mutation SNP C A uc010qhy.1 PCDH15_uc010qhq... Hybrid_Cap... view
PDE4DIP p.Q1665fs 1 144873963 144873963 NCIH23_LUNG 37 Frame_Shift_Del Del T - uc001elw.3 NBPF10_uc009wir... Hybrid_Cap...
PDE4DIP p.V1261L 1 144880847 144880847 NCIH23_LUNG 37 Missense_Mutation SNP C A uc001elw.3 NBPF10_uc009wir... Hybrid_Cap... view
PDGFA 7 540497 540497 NCIH23_LUNG 37 3'UTR Del C - uc003sit.1 PDGFA_uc003sir.... Hybrid_Cap...
PDGFRA 4 55130162 55130162 NCIH23_LUNG 37 Intron Del T - uc003han.3 PDGFRA_uc003haa... Hybrid_Cap...
PDGFRA p.P250H 4 55131206 55131206 NCIH23_LUNG 37 Missense_Mutation SNP C A uc003han.3 PDGFRA_uc003haa... Hybrid_Cap... view
PKHD1 p.E345* 6 51927402 51927402 NCIH23_LUNG 37 Nonsense_Mutation SNP C A uc003pah.1 PKHD1_uc003pai.... Hybrid_Cap... view
PLAT 8 42033407 42033407 NCIH23_LUNG 37 3'UTR SNP G T uc003xos.2 PLAT_uc010lxf.1... Hybrid_Cap... view
PLD1 p.G224S 3 171442574 171442574 NCIH23_LUNG 37 Missense_Mutation SNP C T uc003fhs.2 PLD1_uc003fht.2... Hybrid_Cap... view
PML 15 74326763 74326763 NCIH23_LUNG 37 Intron SNP C T uc002awv.2 PML_uc002awm.2_... Hybrid_Cap... view
PMS2 p.E491K 7 6026925 6026925 NCIH23_LUNG 37 Missense_Mutation SNP C T uc003spl.2 PMS2_uc003spj.2... Hybrid_Cap... view
PPARA p.I446F 22 46631206 46631206 NCIH23_LUNG 37 Missense_Mutation SNP A T uc003bgw.1 PPARA_uc003bgx.... Hybrid_Cap... view
PPARD p.Q374R 6 35393651 35393651 NCIH23_LUNG 37 Missense_Mutation SNP A G uc003okm.2 PPARD_uc003okn.... Hybrid_Cap... view
PPP3CA p.R482W 4 101947144 101947144 NCIH23_LUNG 37 Missense_Mutation SNP T A uc011cen.1 PPP3CA_uc003hvu... Hybrid_Cap... view
PRKAA2 p.R369S 1 57169962 57169962 NCIH23_LUNG 37 Missense_Mutation SNP G T uc001cyk.3 Hybrid_Cap... view
PRKD1 p.Q143P 14 30135390 30135390 NCIH23_LUNG 37 Missense_Mutation SNP T G uc001wqh.2 Hybrid_Cap... view
PRKDC p.L1244fs 8 48805816 48805817 NCIH23_LUNG 37 Frame_Shift_Ins Ins - G rs67588121 uc003xqi.2 PRKDC_uc003xqj.... Hybrid_Cap...
PSIP1 p.Q485* 9 15466825 15466825 NCIH23_LUNG 37 Nonsense_Mutation SNP G A uc003zlv.3 PSIP1_uc003zlw.... Hybrid_Cap... view
PTPRT p.G495V 20 41076936 41076936 NCIH23_LUNG 37 Missense_Mutation SNP C A uc010ggj.2 PTPRT_uc002xkg.... Hybrid_Cap... view
RAD51L1 14 68963956 68963956 NCIH23_LUNG 37 Intron SNP C A uc010aqs.1 RAD51L1_uc001xk... Hybrid_Cap... view
RAPGEF2 p.S1201T 4 160274056 160274056 NCIH23_LUNG 37 Missense_Mutation SNP G C uc003iqg.3 Hybrid_Cap... view
RECQL4 p.R766fs 8 145738768 145738768 NCIH23_LUNG 37 Frame_Shift_Del Del G - uc003zdj.2 Hybrid_Cap...
RET p.R77L 10 43596063 43596063 NCIH23_LUNG 37 Missense_Mutation SNP G T uc001jal.2 RET_uc001jak.1_... Hybrid_Cap... view
RIMS2 8 104987828 104987828 NCIH23_LUNG 37 Intron SNP G C uc003yls.2 RIMS2_uc003ylp.... Hybrid_Cap... view
RIOK3 p.W420C 18 21057148 21057148 NCIH23_LUNG 37 Missense_Mutation SNP G T uc002kui.3 RIOK3_uc010dls.... Hybrid_Cap... view
ROR2 p.P712S 9 94486642 94486642 NCIH23_LUNG 37 Missense_Mutation SNP G A uc004arj.1 ROR2_uc004ari.1... Hybrid_Cap... view
RPS6KB1 p.T140A 17 58003832 58003832 NCIH23_LUNG 37 Missense_Mutation SNP A G uc002ixy.2 RPS6KB1_uc010dd... Hybrid_Cap... view
RPS6KL1 14 75373626 75373627 NCIH23_LUNG 37 3'UTR Ins - TGAT uc001xqx.1 RPS6KL1_uc001xq... Hybrid_Cap...
SDHB 1 17345331 17345331 NCIH23_LUNG 37 3'UTR SNP G C uc001bae.2 Hybrid_Cap... view
SEPT5 p.V272L 22 19709259 19709259 NCIH23_LUNG 37 Missense_Mutation SNP G T uc002zpv.1 SEPT5_uc002zpw.... Hybrid_Cap... view
SMARCA4 p.1598_1599KE>N* 19 11170491 11170492 NCIH23_LUNG 37 Nonsense_Mutation DNP GG TT uc010dxo.2 SMARCA4_uc002mq... Hybrid_Cap...
SPP1 p.R181M 4 88902913 88902913 NCIH23_LUNG 37 Missense_Mutation SNP G T uc011cde.1 SPP1_uc003hra.2... Hybrid_Cap... view
STAG3 p.S592L 7 99798080 99798080 NCIH23_LUNG 37 Missense_Mutation SNP C T uc003utx.1 STAG3_uc010lgs.... Hybrid_Cap... view
STAT1 2 191840353 191840353 NCIH23_LUNG 37 Intron Del T - uc002usj.2 STAT1_uc010fse.... Hybrid_Cap...
STK11 p.W332* 19 1223059 1223059 NCIH23_LUNG 37 Nonsense_Mutation SNP G A uc002lrl.1 Hybrid_Cap... view
STK25 p.T260M 2 242438192 242438192 NCIH23_LUNG 37 Missense_Mutation SNP G A uc002wbm.2 STK25_uc002wbk.... Hybrid_Cap... view
STK31 7 23872024 23872025 NCIH23_LUNG 37 3'UTR Ins - TTTG rs66787534 uc003sws.3 STK31_uc003swt.... Hybrid_Cap...
STK36 p.H713Y 2 219558056 219558056 NCIH23_LUNG 37 Missense_Mutation SNP C T uc002viu.2 STK36_uc002viv.... Hybrid_Cap... view
TAF15 p.GYGGDRGG478del 17 34171663 34171686 NCIH23_LUNG 37 In_Frame_Del Del GGCTA... - uc002hkd.2 TAF15_uc002hkc.... Hybrid_Cap...
TCF21 p.G76E 6 134210762 134210762 NCIH23_LUNG 37 Missense_Mutation SNP G A uc003qei.3 TCF21_uc003qej.... Hybrid_Cap... view
TGFB2 1 218519928 218519929 NCIH23_LUNG 37 5'UTR Ins - AAAC uc001hln.2 TGFB2_uc001hll.... Hybrid_Cap...
TIAM1 p.381_382QG>HW 21 32624325 32624326 NCIH23_LUNG 37 Missense_Mutation DNP CC AG uc002yow.1 TIAM1_uc011adk.... Hybrid_Cap...
TLK1 2 171850178 171850179 NCIH23_LUNG 37 3'UTR Ins - AA rs71008739 uc002ugo.2 TLK1_uc002ugn.2... Hybrid_Cap...
TLR4 p.L260P 9 120475185 120475185 NCIH23_LUNG 37 Missense_Mutation SNP T C rs55799839 uc004bjz.2 TLR4_uc004bka.2... Hybrid_Cap... view
TNF 6 31543404 31543405 NCIH23_LUNG 37 5'UTR Ins - C rs4645838 uc003nui.2 TNF_uc003nuj.2_... Hybrid_Cap...
TOP2B p.H977Y 3 25661472 25661472 NCIH23_LUNG 37 Missense_Mutation SNP G A uc003cdj.2 TOP2B_uc011awn.... Hybrid_Cap... view
TP53 p.M246I 17 7577543 7577543 NCIH23_LUNG 37 Missense_Mutation SNP C G uc002gim.2 TP53_uc002gig.1... Hybrid_Cap... view
TRAF6 p.D490Y 11 36511489 36511489 NCIH23_LUNG 37 Missense_Mutation SNP C A uc001mwr.1 TRAF6_uc001mws.... Hybrid_Cap... view
TRIM33 1 114940211 114940212 NCIH23_LUNG 37 3'UTR Ins - T rs66490349 uc001eew.2 TRIM33_uc010owr... Hybrid_Cap...
TRPM8 p.R22R 2 234835246 234835246 NCIH23_LUNG 37 Silent SNP C A uc002vvh.2 TRPM8_uc010fyj.... Hybrid_Cap... view
TRPM8 p.L412V 2 234862654 234862654 NCIH23_LUNG 37 Missense_Mutation SNP C G uc002vvh.2 TRPM8_uc010fyj.... Hybrid_Cap... view
TSSK6 19 19625333 19625333 NCIH23_LUNG 37 3'UTR SNP T G uc002nmr.2 TSSK6_uc002nmq.... Hybrid_Cap... view
TTN p.P32127T 2 179397259 179397259 NCIH23_LUNG 37 Missense_Mutation SNP G T uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap... view
TTN p.A24270S 2 179430347 179430347 NCIH23_LUNG 37 Missense_Mutation SNP C A uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap... view
TTN p.P21491T 2 179438684 179438684 NCIH23_LUNG 37 Missense_Mutation SNP G T uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap... view
TTN p.T20514N 2 179441817 179441817 NCIH23_LUNG 37 Missense_Mutation SNP G T uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap... view
TTN p.L13397I 2 179481723 179481723 NCIH23_LUNG 37 Missense_Mutation SNP A T uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap... view
TTN p.P10696T 2 179516468 179516468 NCIH23_LUNG 37 Missense_Mutation SNP G T uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap... view
TTN p.W7149C 2 179582422 179582422 NCIH23_LUNG 37 Missense_Mutation SNP C A uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap... view
TTN 2 179614274 179614274 NCIH23_LUNG 37 Intron SNP G T uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap... view
TTN p.T2428A 2 179638613 179638613 NCIH23_LUNG 37 Missense_Mutation SNP T C uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap... view
USP6 p.T693fs 17 5048786 5048787 NCIH23_LUNG 37 Frame_Shift_Del Del AT - uc002gau.1 USP6_uc002gav.1... Hybrid_Cap...
VEGFC p.S419_splice 4 177605082 177605084 NCIH23_LUNG 37 Splice_Site_Del Del TCA - uc003ius.1 Hybrid_Cap...
ZAP70 p.S602R 2 98355907 98355907 NCIH23_LUNG 37 Missense_Mutation SNP C A uc002syd.1 ZAP70_uc002sye.... Hybrid_Cap... view