Annotation Summary for Cell Line: SU-DHL-6  

Cell line primary name: SU-DHL-6
Cell line aliases:
Gender: M
Site Primary: haematopoietic_and_lymphoid_tissue
Histology: lymphoid_neoplasm
Hist Subtype1: diffuse_large_B_cell_lymphoma
Notes:
Source: DSMZ
Expression arrays: WATCH_p_NCLE_RNA8_HG-U133_Plus_2_F08_474592
SNP arrays: CHARY_p_NCLE_DNAAffy9_GenomeWideSNP_6_C01_490348
Oncomap: yes
Hybrid Capture Sequencing: yes


Mutations in SU-DHL-6

GeneProtein
Change
ChrStartEnd SampleNCBI
Build
Variant
Classification
Variant TypeReference
Allele
Tumor
Allele 1
dbSNP IDAnnotation
Transcript
Other
Transcripts
Method View
Reads
Mutation
Assessor
AAK1 p.541_542QQ>Q 2 69741754 69741756 SUDHL6_HAEMATOP... 37 In_Frame_Del Del TGT - rs55712143 uc002sfp.2 AAK1_uc010fdk.2... Hybrid_Cap...
ADAM12 p.H300Y 10 127789663 127789663 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP G A uc001ljk.2 ADAM12_uc010qul... Hybrid_Cap... view
ADAM17 2 9630245 9630245 SUDHL6_HAEMATOP... 37 3'UTR Del T - uc002qzu.2 IAH1_uc010yiz.1... Hybrid_Cap...
ADAM28 8 24211994 24211997 SUDHL6_HAEMATOP... 37 3'UTR Del CTAT - rs10610134 uc003xdy.2 ADAM28_uc011laa... Hybrid_Cap...
AKAP12 p.1531_1532insE 6 151674116 151674117 SUDHL6_HAEMATOP... 37 In_Frame_Ins Ins - GAG rs34737819 uc011eep.1 AKAP12_uc003qoe... Hybrid_Cap...
ALPK1 4 113347609 113347610 SUDHL6_HAEMATOP... 37 Intron Ins - T rs68137453 uc003iap.3 ALPK1_uc003ian.... Hybrid_Cap...
ALPK2 p.EDTST1006del 18 56204388 56204402 SUDHL6_HAEMATOP... 37 In_Frame_Del Del CAGTT... - rs60644017;rs117623369 uc002lhj.3 ALPK2_uc002lhk.... Hybrid_Cap...
BCL2 18 60985201 60985201 SUDHL6_HAEMATOP... 37 Intron Del T - uc002lit.1 BCL2_uc002liu.1... Hybrid_Cap...
BCL2 18 60985219 60985219 SUDHL6_HAEMATOP... 37 Intron SNP A G uc002lit.1 BCL2_uc002liu.1... Hybrid_Cap... view
BCL2 p.R129C 18 60985515 60985515 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP G A uc002lit.1 BCL2_uc002liu.1... Hybrid_Cap... view
BMPR2 p.L1038L 2 203424666 203424666 SUDHL6_HAEMATOP... 37 Silent SNP G A uc002uzf.3 BMPR2_uc010ftr.... Hybrid_Cap... view
BRD2 6 32948607 32948608 SUDHL6_HAEMATOP... 37 3'UTR Ins - T rs1049414;rs114195059 uc010juh.2 BRD2_uc003ocn.3... Hybrid_Cap...
CDH2 18 25532007 25532007 SUDHL6_HAEMATOP... 37 3'UTR SNP C G uc002kwg.2 CDH2_uc010xbn.1... Hybrid_Cap... view
CDK11B 1 1654066 1654068 SUDHL6_HAEMATOP... 37 Intron Del GCG - uc001agv.1 CDK11B_uc001aha... Hybrid_Cap...
CHD1 p.P1684del 5 98192165 98192167 SUDHL6_HAEMATOP... 37 In_Frame_Del Del AGG - rs79267787;rs61749618 uc003knf.2 CHD1_uc010jbn.2... Hybrid_Cap...
CLTCL1 p.V1201_splice 22 19189003 19189004 SUDHL6_HAEMATOP... 37 Splice_Site_Ins Ins - C rs11386977 uc002zpb.2 CLTCL1_uc011agv... Hybrid_Cap...
CLTCL1 22 19196673 19196674 SUDHL6_HAEMATOP... 37 Intron Ins - A uc002zpb.2 CLTCL1_uc011agv... Hybrid_Cap...
CNTN6 3 1339681 1339686 SUDHL6_HAEMATOP... 37 Intron Del GTTTT... - uc003boz.2 CNTN6_uc010hbo.... Hybrid_Cap...
CREBBP p.L470fs 16 3832849 3832849 SUDHL6_HAEMATOP... 37 Frame_Shift_Del Del A - uc002cvv.2 CREBBP_uc002cvw... Hybrid_Cap...
DYRK1A 21 38884966 38884967 SUDHL6_HAEMATOP... 37 3'UTR Ins - T rs72430212 uc002ywk.2 DYRK1A_uc002ywi... Hybrid_Cap...
EP300 p.R1627W 22 41572350 41572350 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP C T uc003azl.3 Hybrid_Cap... view
EPHA2 p.V255fs 1 16474932 16474933 SUDHL6_HAEMATOP... 37 Frame_Shift_Ins Ins - CC rs79100278 uc001aya.1 EPHA2_uc010oca.... Hybrid_Cap...
EPHA6 3 97367230 97367231 SUDHL6_HAEMATOP... 37 Intron Ins - A rs115253553 uc010how.1 EPHA6_uc003drs.... Hybrid_Cap...
ERBB4 p.N1044S 2 212285170 212285170 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP T C uc002veg.1 ERBB4_uc002veh.... Hybrid_Cap... view
FBN2 p.R126H 5 127866347 127866347 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP C T uc003kuu.2 FBN2_uc003kuv.2... Hybrid_Cap... view
FGFR1OP 6 167453519 167453520 SUDHL6_HAEMATOP... 37 3'UTR Ins - T rs115519488 uc003qvj.2 CCR6_uc003qvl.2... Hybrid_Cap...
FLI1 11 128638217 128638217 SUDHL6_HAEMATOP... 37 Intron Del G - uc010sbu.1 FLI1_uc010sbt.1... Hybrid_Cap...
FLNC p.Y730S 7 128482352 128482352 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP A C uc003vnz.3 FLNC_uc003voa.3... Hybrid_Cap... view
FN1 2 216244182 216244185 SUDHL6_HAEMATOP... 37 Intron Del GTAC - uc002vfa.2 FN1_uc002vfb.2_... Hybrid_Cap...
FN1 p.R107P 2 216298142 216298142 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP C G uc002vfa.2 FN1_uc002vfb.2_... Hybrid_Cap... view
FSCB p.679_679P>PSEVQPPPAEEAP 14 44974154 44974155 SUDHL6_HAEMATOP... 37 In_Frame_Ins Ins - GGGGCCTCCTCAGCTGGTGGAGGCTGAACTTCAGAG uc001wvn.2 Hybrid_Cap...
GPR112 p.D2657del X 135474445 135474447 SUDHL6_HAEMATOP... 37 In_Frame_Del Del GAT - rs3030295 uc004ezu.1 GPR112_uc010nsb... Hybrid_Cap...
GRIA3 X 122318386 122318387 SUDHL6_HAEMATOP... 37 Splice_Site_Ins Ins - G rs66632982 uc004etq.3 GRIA3_uc004etr.... Hybrid_Cap...
GRK4 p.D399N 4 3031062 3031062 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP G A uc003ggn.1 GRK4_uc003ggo.1... Hybrid_Cap... view
GRK7 p.I467F 3 141535629 141535629 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP A T uc011bnd.1 Hybrid_Cap... view
GUCY2C 12 14827464 14827466 SUDHL6_HAEMATOP... 37 Intron Del ATC - rs72525754;rs3083879 uc001rcd.2 GUCY2C_uc009zhz... Hybrid_Cap...
HERC2 p.T1113I 15 28491941 28491941 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP G A uc001zbj.2 Hybrid_Cap... view
ILK 11 6630029 6630029 SUDHL6_HAEMATOP... 37 Intron Del C - uc001mee.2 ILK_uc001mef.2_... Hybrid_Cap...
INHBA 7 41729111 41729112 SUDHL6_HAEMATOP... 37 3'UTR Ins - T rs116913029 uc003thq.2 INHBA_uc003thr.... Hybrid_Cap...
ITGB1 10 33197131 33197134 SUDHL6_HAEMATOP... 37 Intron Del CTTT - rs116966876 uc001iwq.3 ITGB1_uc001iwp.... Hybrid_Cap...
ITPR1 p.F263L 3 4687346 4687346 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP C A uc003bqa.2 ITPR1_uc010hbz.... Hybrid_Cap... view
ITPR2 p.R470_splice 12 26834804 26834805 SUDHL6_HAEMATOP... 37 Splice_Site_Ins Ins - ACTC rs66696203;rs59199365 uc001rhg.2 Hybrid_Cap...
KLK7 19 51480672 51480675 SUDHL6_HAEMATOP... 37 3'UTR Del GGTT - uc002puo.2 KLK7_uc002pup.2... Hybrid_Cap...
LAMA1 p.V1049M 18 7014032 7014032 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP C T uc002knm.2 LAMA1_uc010wzj.... Hybrid_Cap... view
LETM2 8 38262065 38262065 SUDHL6_HAEMATOP... 37 Intron SNP A G uc003xlm.1 LETM2_uc011lbn.... Hybrid_Cap... view
LRP6 p.G791E 12 12312806 12312806 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP C T uc001rah.3 BCL2L14_uc001ra... Hybrid_Cap... view
LRRC7 1 70587626 70587626 SUDHL6_HAEMATOP... 37 3'UTR SNP A T uc001dep.2 LRRC7_uc009wbg.... Hybrid_Cap... view
MAF 16 79628537 79628537 SUDHL6_HAEMATOP... 37 Intron Del T - uc002ffm.2 MAF_uc002ffn.2_... Hybrid_Cap...
MAML3 p.Q767_splice 4 140651585 140651587 SUDHL6_HAEMATOP... 37 Splice_Site_Del Del CTG - uc003ihz.1 MGST2_uc010ioi.... Hybrid_Cap...
MAP3K1 p.T949del 5 56177849 56177851 SUDHL6_HAEMATOP... 37 In_Frame_Del Del CAA - uc003jqw.3 Hybrid_Cap...
MAP3K14 p.R218_splice 17 43364293 43364294 SUDHL6_HAEMATOP... 37 Splice_Site_Ins Ins - G rs66766023 uc002iiw.1 MAP3K14_uc010da... Hybrid_Cap...
MAP3K5 p.988_989insD 6 136913666 136913667 SUDHL6_HAEMATOP... 37 In_Frame_Ins Ins - GTC uc003qhc.2 MAP3K5_uc011edj... Hybrid_Cap...
MAPKAPK3 3 50685575 50685575 SUDHL6_HAEMATOP... 37 3'UTR Del A - rs76026164 uc003day.1 MAPKAPK3_uc003d... Hybrid_Cap...
MEF2A p.QQ428del 15 100252710 100252715 SUDHL6_HAEMATOP... 37 In_Frame_Del Del CAGCA... - uc010urw.1 MEF2A_uc010urv.... Hybrid_Cap...
MYD88 p.S219C 3 38182032 38182032 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP C G uc003chx.2 MYD88_uc011ayh.... Hybrid_Cap... view
NCAM1 11 112832307 112832308 SUDHL6_HAEMATOP... 37 5'UTR Ins - A rs117108942 uc009yyq.1 NCAM1_uc001pno.... Hybrid_Cap...
NCAM1 11 112832340 112832340 SUDHL6_HAEMATOP... 37 5'UTR Del C - uc009yyq.1 NCAM1_uc001pno.... Hybrid_Cap...
NEK3 p.K313_splice 13 52718050 52718051 SUDHL6_HAEMATOP... 37 Splice_Site_Ins Ins - T rs72514762 uc001vgh.2 NEK3_uc001vgg.2... Hybrid_Cap...
NEK4 p.W428* 3 52786032 52786032 SUDHL6_HAEMATOP... 37 Nonsense_Mutation SNP C T uc003dfq.3 NEK4_uc011bej.1... Hybrid_Cap... view
NEK9 p.E614_splice 14 75568358 75568358 SUDHL6_HAEMATOP... 37 Splice_Site_SNP SNP A G uc001xrl.2 NEK9_uc001xrk.2... Hybrid_Cap... view
NLRP3 1 247611982 247611982 SUDHL6_HAEMATOP... 37 3'UTR Del C - uc001icr.2 NLRP3_uc001ics.... Hybrid_Cap...
NLRP6 p.L768I 11 284330 284330 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP C A uc010qvs.1 NLRP6_uc010qvt.... Hybrid_Cap... view
NPM1 5 170837734 170837734 SUDHL6_HAEMATOP... 37 3'UTR Del T - uc011dex.1 NPM1_uc003mbi.2... Hybrid_Cap...
NPR1 1 153665919 153665920 SUDHL6_HAEMATOP... 37 3'UTR Ins - C rs66682713 uc001fcs.3 NPR1_uc010pdz.1... Hybrid_Cap...
NR1H2 p.176_177insQ 19 50881822 50881823 SUDHL6_HAEMATOP... 37 In_Frame_Ins Ins - CAG rs61751954;rs1052533 uc010enw.2 NR1H2_uc002prv.... Hybrid_Cap...
OLFM4 p.V387V 13 53624534 53624534 SUDHL6_HAEMATOP... 37 Silent SNP G A uc001vhl.2 OLFM4_uc001vhk.... Hybrid_Cap... view
PAX3 2 223158653 223158653 SUDHL6_HAEMATOP... 37 Intron Del T - rs112753212 uc002vmt.1 PAX3_uc002vmy.1... Hybrid_Cap...
PDE4DIP 1 144863175 144863175 SUDHL6_HAEMATOP... 37 Intron SNP C T uc001elw.3 NBPF10_uc009wir... Hybrid_Cap... view
PDE4DIP 1 144863548 144863548 SUDHL6_HAEMATOP... 37 Intron SNP A C uc001elw.3 NBPF10_uc009wir... Hybrid_Cap... view
PDE4DIP p.Q1665fs 1 144873963 144873963 SUDHL6_HAEMATOP... 37 Frame_Shift_Del Del T - uc001elw.3 NBPF10_uc009wir... Hybrid_Cap...
PDE4DIP p.V486fs 1 144917828 144917828 SUDHL6_HAEMATOP... 37 Frame_Shift_Del Del A - uc001elw.3 NBPF10_uc009wir... Hybrid_Cap...
PGR 11 100933598 100933599 SUDHL6_HAEMATOP... 37 Intron Ins - AATGA rs35148438 uc001pgh.2 PGR_uc001pgg.2_... Hybrid_Cap...
PIK3C2G p.P129del 12 18435399 18435401 SUDHL6_HAEMATOP... 37 In_Frame_Del Del CCC - uc010sib.1 PIK3C2G_uc001rd... Hybrid_Cap...
PIP4K2A 10 22825887 22825887 SUDHL6_HAEMATOP... 37 3'UTR Del C - uc001irl.3 PIP4K2A_uc010qc... Hybrid_Cap...
PMS1 2 190670539 190670540 SUDHL6_HAEMATOP... 37 Intron Ins - A rs3214425 uc002urh.3 PMS1_uc010zga.1... Hybrid_Cap...
PPP1R3A 7 113559061 113559061 SUDHL6_HAEMATOP... 37 5'UTR SNP T C uc010ljy.1 Hybrid_Cap... view
PRKCA 17 64298959 64298960 SUDHL6_HAEMATOP... 37 5'UTR Ins - G rs71160558 uc002jfp.1 PRKCA_uc002jfo.... Hybrid_Cap...
PRKCA p.Y285N 17 64685100 64685100 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP T A uc002jfp.1 PRKCA_uc002jfo.... Hybrid_Cap... view
PRKCE 2 45879124 45879124 SUDHL6_HAEMATOP... 37 5'UTR SNP G A uc002rut.2 Hybrid_Cap... view
PRKDC p.L1244fs 8 48805816 48805817 SUDHL6_HAEMATOP... 37 Frame_Shift_Ins Ins - G rs67588121 uc003xqi.2 PRKDC_uc003xqj.... Hybrid_Cap...
RECQL4 p.R766fs 8 145738768 145738768 SUDHL6_HAEMATOP... 37 Frame_Shift_Del Del G - uc003zdj.2 Hybrid_Cap...
REL 2 61149756 61149756 SUDHL6_HAEMATOP... 37 3'UTR SNP A C uc002sam.1 REL_uc002san.1_... Hybrid_Cap... view
SHC1 p.D269N 1 154940507 154940507 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP C T uc001ffw.2 SHC1_uc001ffu.2... Hybrid_Cap... view
TLR4 p.C306Y 9 120475323 120475323 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP G A uc004bjz.2 TLR4_uc004bka.2... Hybrid_Cap... view
TMEM123 11 102269398 102269398 SUDHL6_HAEMATOP... 37 3'UTR Del G - uc001pha.2 TMEM123_uc009yx... Hybrid_Cap...
TOP1 p.E561K 20 39744053 39744053 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP G A uc002xjl.2 Hybrid_Cap... view
TOX3 p.T350I 16 52473819 52473819 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP G A uc010vgu.1 TOX3_uc002egw.2... Hybrid_Cap... view
TP53 p.Y234C 17 7577580 7577580 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP T C uc002gim.2 TP53_uc002gig.1... Hybrid_Cap... view
TP53 p.V225_splice 17 7577610 7577610 SUDHL6_HAEMATOP... 37 Splice_Site_SNP SNP T A uc002gim.2 TP53_uc002gig.1... Hybrid_Cap... view
TRIM33 1 114940215 114940216 SUDHL6_HAEMATOP... 37 3'UTR Ins - G rs68133208 uc001eew.2 TRIM33_uc010owr... Hybrid_Cap...
TTL p.Y309* 2 113277910 113277910 SUDHL6_HAEMATOP... 37 Nonsense_Mutation SNP C G uc002thu.2 TTL_uc010fkm.1_... Hybrid_Cap... view
TTN 2 179391639 179391640 SUDHL6_HAEMATOP... 37 3'UTR Ins - T rs36037175 uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap...
TTN p.T26269N 2 179424349 179424349 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP G T uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap... view
TTN p.R18641* 2 179452411 179452411 SUDHL6_HAEMATOP... 37 Nonsense_Mutation SNP G A uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap... view
TTN p.9928_9928E>EE 2 179544685 179544686 SUDHL6_HAEMATOP... 37 In_Frame_Ins Ins - TCT uc010zfg.1 TTN_uc010zfh.1_... Hybrid_Cap...
VEGFC p.S419_splice 4 177605082 177605084 SUDHL6_HAEMATOP... 37 Splice_Site_Del Del TCA - uc003ius.1 Hybrid_Cap...
WHSC1 p.G325D 4 1919914 1919914 SUDHL6_HAEMATOP... 37 Missense_Mutation SNP G A uc003gdz.3 WHSC1_uc003geb.... Hybrid_Cap... view