Construct: shRNA TRCN0000231713

Construct Description:

Construct Type:
shRNA
Other Identifiers:
lacZ_2082s21c1
DNA Barcode:
ACTCTGGCTAACGGTACGCGT

Original Target:

Original Target:

Taxon:
Control
Gene:
lacZ (lacZ)
Gene Description:
lacZ
Transcript:
Broad lacZ.1 (CURRENT)
Match location:
Position 2082 (CDS)

Vector Information:

Vector Backbone:
pLKO_TRC005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000231713)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL lacZ lacZ lacZ lacZ.1 100% CDS 2082 0.220 N/A
2 CONTROL LacZ LacZ Hahn Lab LacZ LacZ.1 89% CDS 2067 N/A N/A
3 human 8284 KDM5D lysine demethylase 5D XM_005262560.2 89% 3UTR 17119 N/A N/A
4 human 8284 KDM5D lysine demethylase 5D XM_005262561.2 89% 3UTR 17023 N/A N/A
5 human 8284 KDM5D lysine demethylase 5D XM_011531468.2 89% 3UTR 17176 N/A N/A
6 human 8284 KDM5D lysine demethylase 5D XR_001756009.1 89% 3UTR 17705 N/A N/A
7 human 8284 KDM5D lysine demethylase 5D XR_001756010.1 89% 3UTR 17673 N/A N/A
8 human 8284 KDM5D lysine demethylase 5D XR_001756011.1 89% 3UTR 17570 N/A N/A
9 human 8284 KDM5D lysine demethylase 5D XR_001756012.1 89% 3UTR 17718 N/A N/A
10 human 8284 KDM5D lysine demethylase 5D XR_001756013.1 89% 3UTR 17036 N/A N/A
11 human 8284 KDM5D lysine demethylase 5D XR_244571.3 89% 3UTR 17222 N/A N/A
12 mouse 102632 Acad11 acyl-Coenzyme A dehydrogena... NM_175324.3 85% CDS 2270 N/A N/A
13 mouse 102632708 Gm15523 predicted gene 15523 XR_001780679.1 85% 3UTR 1645 N/A N/A
14 mouse 102632708 Gm15523 predicted gene 15523 XR_381867.1 85% 3UTR 1799 N/A N/A
15 mouse 102632708 Gm15523 predicted gene 15523 XR_381868.1 85% 3UTR 1296 N/A N/A
16 mouse 102632708 Gm15523 predicted gene 15523 XR_872949.2 85% 3UTR 1115 N/A N/A
17 mouse 102632708 Gm15523 predicted gene 15523 XR_872950.2 85% 3UTR 1874 N/A N/A
18 mouse 102632708 Gm15523 predicted gene 15523 XR_872951.1 85% 3UTR 876 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACTCTGGCTAACGGTACGCGT
Hairpin Sequence:
5'-CCGG-ACTCTGGCTAACGGTACGCGT-CTCGAG-ACGCGTACCGTTAGCCAGAGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACTCTGGCTAACGGTACGCGTCTCGAGACGCGTACCGTTAGCCAGAGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACTCTGGCTAACGGTACGCGTCTCGAGACGCGTACCGTTAGCCAGAGT-3'

Other clones with same target sequence:

  1. TRCN0000072228