Construct: shRNA TRCN0000231714

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_228s21c1
DNA Barcode:
CAGAATCGTCGTATGCAGTGA

Original Target:

Original Target:

Taxon:
Control
Gene:
LUCIFERASE (LUCIFERASE)
Gene Description:
promegaLuc
Transcript:
Broad promegaLuc.1 (CURRENT)
Match location:
Position 228 (CDS)

Vector Information:

Vector Backbone:
pLKO_TRC005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000231714)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL LUCIFERASE LUCIFERASE promegaLuc promegaLuc.1 100% CDS 228 2.640 N/A
2 CONTROL Luciferase Luciferase Hahn Lab Luciferase Luciferase.1 100% CDS 228 2.640 N/A
3 mouse 74333 A330040F15Rik RIKEN cDNA A330040F15 gene NR_015503.1 89% 3UTR 788 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CAGAATCGTCGTATGCAGTGA
Hairpin Sequence:
5'-CCGG-CAGAATCGTCGTATGCAGTGA-CTCGAG-TCACTGCATACGACGATTCTG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCAGAATCGTCGTATGCAGTGACTCGAGTCACTGCATACGACGATTCTGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACAGAATCGTCGTATGCAGTGACTCGAGTCACTGCATACGACGATTCTG-3'

Other clones with same target sequence:

  1. TRCN0000072260