Search by Clone

Clone IDs, Target sequences, or DNA barcodes:


Example search terms:
shRNA:
'TRCN0000000677', 'AGACTCTGAGTACAAAGTGAA' (21mer target sequence or barcode)
ORF:
'ccsbBroad304_12345', 'ACGTCGTCGTCGGAAGCTCCGACC' (26mer barcode)