Gene: Luciferase (Luciferase)

Hahn Lab Luciferase

Wildtype Transcripts:

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene Luciferase (Luciferase), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072254 ATGTTTACTACACTCGGATAT pLKO.1 Luciferase.1 CDS 100% 10.800 N/A N/A LUCIFERASE
2 TRCN0000231737 ATGTTTACTACACTCGGATAT pLKO_TRC005 Luciferase.1 CDS 100% 10.800 N/A N/A LUCIFERASE
3 TRCN0000072258 TGTCCGGTTATGTAAACAATC pLKO.1 Luciferase.1 CDS 100% 10.800 N/A N/A LUCIFERASE
4 TRCN0000231721 TGTCCGGTTATGTAAACAATC pLKO_TRC005 Luciferase.1 CDS 100% 10.800 N/A N/A LUCIFERASE
5 TRCN0000072253 ACACTCGGATATTTGATATGT pLKO.1 Luciferase.1 CDS 100% 5.625 N/A N/A LUCIFERASE
7 TRCN0000072256 ACGCTGAGTACTTCGAAATGT pLKO.1 Luciferase.1 CDS 100% 5.625 N/A N/A LUCIFERASE
9 TRCN0000072250 AGAATCGTCGTATGCAGTGAA pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
10 TRCN0000231730 AGAATCGTCGTATGCAGTGAA pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
11 TRCN0000072246 CAAATCACAGAATCGTCGTAT pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
12 TRCN0000231699 CAAATCACAGAATCGTCGTAT pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
13 TRCN0000072261 CACTCGGATATTTGATATGTG pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
14 TRCN0000231707 CACTCGGATATTTGATATGTG pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
15 TRCN0000072259 CGCTGAGTACTTCGAAATGTC pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
16 TRCN0000231715 CGCTGAGTACTTCGAAATGTC pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
17 TRCN0000072247 GAATCGTCGTATGCAGTGAAA pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
18 TRCN0000231720 GAATCGTCGTATGCAGTGAAA pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
19 TRCN0000072265 GTTGTGTTTGTGGACGAAGTA pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
20 TRCN0000231727 GTTGTGTTTGTGGACGAAGTA pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
21 TRCN0000072248 AGTCAAGTAACAACCGCGAAA pLKO.1 Luciferase.1 CDS 100% 4.050 N/A N/A LUCIFERASE
22 TRCN0000231718 AGTCAAGTAACAACCGCGAAA pLKO_TRC005 Luciferase.1 CDS 100% 4.050 N/A N/A LUCIFERASE
23 TRCN0000072252 ACTTACGCTGAGTACTTCGAA pLKO.1 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
24 TRCN0000231733 ACTTACGCTGAGTACTTCGAA pLKO_TRC005 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
25 TRCN0000072244 ATCACAGAATCGTCGTATGCA pLKO.1 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
26 TRCN0000231695 ATCACAGAATCGTCGTATGCA pLKO_TRC005 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
27 TRCN0000072255 TCTACTGGTCTGCCTAAAGGT pLKO.1 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
28 TRCN0000231734 TCTACTGGTCTGCCTAAAGGT pLKO_TRC005 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
29 TRCN0000072262 CACTTACGCTGAGTACTTCGA pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
30 TRCN0000231736 CACTTACGCTGAGTACTTCGA pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
31 TRCN0000072260 CAGAATCGTCGTATGCAGTGA pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
32 TRCN0000231714 CAGAATCGTCGTATGCAGTGA pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
33 TRCN0000072243 CTTCGAAATGTCCGTTCGGTT pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
34 TRCN0000231693 CTTCGAAATGTCCGTTCGGTT pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
35 TRCN0000072266 GAATGTTTACTACACTCGGAT pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
36 TRCN0000231729 GAATGTTTACTACACTCGGAT pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
37 TRCN0000072251 GAGTACTTCGAAATGTCCGTT pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
38 TRCN0000231728 GAGTACTTCGAAATGTCCGTT pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
39 TRCN0000072264 GCTGAGTACTTCGAAATGTCC pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
40 TRCN0000231741 GCTGAGTACTTCGAAATGTCC pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
41 TRCN0000072245 TCACAGAATCGTCGTATGCAG pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
42 TRCN0000231697 TCACAGAATCGTCGTATGCAG pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
43 TRCN0000072263 AGTACTTCGAAATGTCCGTTC pLKO.1 Luciferase.1 CDS 100% 2.250 N/A N/A LUCIFERASE
44 TRCN0000231739 AGTACTTCGAAATGTCCGTTC pLKO_TRC005 Luciferase.1 CDS 100% 2.250 N/A N/A LUCIFERASE
45 TRCN0000072249 GCGGTTGCCAAGAGGTTCCAT pLKO.1 Luciferase.1 CDS 100% 1.000 N/A N/A LUCIFERASE
46 TRCN0000231719 GCGGTTGCCAAGAGGTTCCAT pLKO_TRC005 Luciferase.1 CDS 100% 1.000 N/A N/A LUCIFERASE
47 TRCN0000072267 GCGCCATTCTATCCGCTGGAA pLKO.1 Luciferase.1 CDS 100% 0.880 N/A N/A LUCIFERASE
48 TRCN0000231731 GCGCCATTCTATCCGCTGGAA pLKO_TRC005 Luciferase.1 CDS 100% 0.880 N/A N/A LUCIFERASE
49 TRCN0000072257 TGAGTACTTCGAAATGTCCGT pLKO.1 Luciferase.1 CDS 100% 0.660 N/A N/A LUCIFERASE
50 TRCN0000231740 TGAGTACTTCGAAATGTCCGT pLKO_TRC005 Luciferase.1 CDS 100% 0.660 N/A N/A LUCIFERASE
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene Luciferase (Luciferase), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 BRDN0000464768 CONTROL Luciferase.1 Luciferase Luciferase pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99992 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99991 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99993 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99982 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99991 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC304 18.9% 100% 100% V5 N/A
7 ccsbBroad304_99992 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC304 18.9% 100% 100% V5 N/A
8 BRDN0000559440 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC307 0% 100% 100% V5 N/A
9 BRDN0000464779 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC302 0% 100% 100% V5 N/A
10 BRDN0000556282 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC303 0% 100% 100% None N/A
11 BRDN0000556262 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC305 0% 100% 100% None N/A
12 BRDN0000556299 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC306 0% 100% 100% V5 N/A
13 BRDN0000556280 CONTROL Luciferase.1 Luciferase Luciferase pLXI_TRC401 0% 100% 100% None N/A
14 BRDN0000556275 CONTROL Luciferase.1 Luciferase Luciferase pLXI_TRC402 0% 100% 100% HA N/A
15 BRDN0000556301 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC311 0% 100% 100% V5 N/A
16 BRDN0000556296 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC312 0% 100% 100% V5 N/A
17 BRDN0000556302 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC313 0% 100% 100% V5 N/A
18 BRDN0000556293 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC314 0% 100% 100% V5 N/A
19 BRDN0000556270 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC315 0% 100% 100% V5 N/A
20 BRDN0000556289 CONTROL Luciferase.1 Luciferase Luciferase pLXI_TRC403 0% 100% 100% V5 N/A
21 BRDN0000559468 CONTROL Luciferase.1 Luciferase Luciferase CTAATATACAACCGATTAATCATC pLX_TRC317 30.3% 100% 100% V5 N/A
22 ccsbBroad304_99993 CONTROL Luciferase.1 Luciferase Luciferase pLX_TRC304 44.2% 76.8% 56.5% V5 (not translated due to prior stop codon) (many diffs)
23 BRDN0000464769 CONTROL Luciferase.1 Luciferase Luciferase pDONR223 0% 100% 100% None N/A
24 BRDN0000464770 CONTROL Luciferase.1 Luciferase Luciferase pDONR223 0% 100% 100% None N/A
Download CSV