Construct: shRNA TRCN0000164614
Construct Description:
- Construct Type:
- shRNA
- Other Identifiers:
- NM_016534.2-1349s1c1
- DNA Barcode:
- CGATAACCTATCAAAGGGCTT
Original Target:
- Taxon:
-
Homo sapiens (human)
- Gene:
- MAPKAPK5-AS1 (51275)
- Gene Description:
- MAPKAPK5 antisense RNA 1
- Transcript:
- RefSeq NM_016534.2 (NON-CURRENT)
- Match location:
- Position 1349 (3UTR)
Vector Information:
- Vector Backbone:
- pLKO.1
- Pol II Cassette 1:
- PGK-PuroR
- Pol II Cassette 2:
- n/a
- Pol III Promoter:
- constitutive hU6
- Pol III Insert:
- (TRCN0000164614)
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
Current transcripts matched by this shRNA:
| Taxon |
Gene |
Symbol |
Description |
Transcript |
SDR Match %[?]Percent match of the "Specificity-Defining Region" of the hairpin target sequence to transcript RNA sequence. The SDR is defined as the initial 19 bases of the (21mer) target sequence.
| 84% | = 16/19 | | 89% | = 17/19 | | 95% | = 18/19 | | 100% | = 19/19 |
|
Region |
Start Pos.[?]Start position of hairpin's match to the targetted transcript sequence (1-based). |
Intrinsic Score[?]Also called "original score", this assesses the target sequence for predicted cloneability and knockdown performance. |
Adjusted Score[?]Also called "specificity score", this is a function of the intrinsic score and the specificity factor. |
| 1 |
human |
51275 |
MAPKAPK5-AS1 |
MAPKAPK5 antisense RNA 1 |
NR_015404.2 |
100% |
3UTR |
1452 |
2.160 |
3.024 |
| 2 |
human |
51275 |
MAPKAPK5-AS1 |
MAPKAPK5 antisense RNA 1 |
NR_152605.1 |
100% |
3UTR |
377 |
2.160 |
3.024 |
| 3 |
human |
51275 |
MAPKAPK5-AS1 |
MAPKAPK5 antisense RNA 1 |
NR_152606.1 |
100% |
3UTR |
377 |
2.160 |
3.024 |
Sequence Information
- Target Sequence:
- CGATAACCTATCAAAGGGCTT
- Hairpin Sequence:
-
5'-CCGG-CGATAACCTATCAAAGGGCTT-CTCGAG-AAGCCCTTTGATAGGTTATCG-TTTTTTG-3'
Oligo design for arrayed cloning:
- Forward sequence:
- 5'-CCGGCGATAACCTATCAAAGGGCTTCTCGAGAAGCCCTTTGATAGGTTATCGTTTTTG-3'
- Reverse sequence:
- 5'-AATTCAAAAACGATAACCTATCAAAGGGCTTCTCGAGAAGCCCTTTGATAGGTTATCG-3'
Other clones with same target sequence:
(none)
