Construct: shRNA TRCN0000303643  
  
    Construct Description:
    
      - Construct Type:
  - shRNA
 
      - Other Identifiers:
  - NM_003069.3-3501s21c1
 
                    - DNA Barcode:
  - GTGTATTCATGGTACTCTAAG
 
             
       
    
          Original Target:
        
          - Taxon:
  - 
                          Homo sapiens (human)                      
 
                      - Gene:
  - SMARCA1 (6594)
 
            - Gene Description:
  - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1
 
                          - Transcript:
  - RefSeq NM_003069.3 (NON-CURRENT)
 
              - Match location:
  - Position 3501 (3UTR)
 
                                        
 
       
  
    Vector Information:
    
      - Vector Backbone:
  - pLKO_005
 
      - Pol II Cassette 1:
 - PGK-PuroR
 - Pol II Cassette 2:
 - n/a
 - Pol III Promoter:
 - constitutive hU6
 - Pol III Insert:
 - (TRCN0000303643)
 - Selection Marker:
 - PuroR
 - Visible Reporter:
 - n/a
     
       
 
  Current transcripts matched by this shRNA:
  
  
      Sequence Information
    
      - Target Sequence:
  - GTGTATTCATGGTACTCTAAG
 
      - Hairpin Sequence:
  - 
        5'-CCGG-GTGTATTCATGGTACTCTAAG-CTCGAG-CTTAGAGTACCATGAATACAC-TTTTTG-3'
 
    
    Oligo design for arrayed cloning:
    
      - Forward sequence:
  - 5'-CCGGGTGTATTCATGGTACTCTAAGCTCGAGCTTAGAGTACCATGAATACACTTTTTG-3'
 
      - Reverse sequence:
  - 5'-AATTCAAAAAGTGTATTCATGGTACTCTAAGCTCGAGCTTAGAGTACCATGAATACAC-3'
 
    
    Other clones with same target sequence:
    (none)