Construct: shRNA TRCN0000373969

Construct Description:

Construct Type:
shRNA
Other Identifiers:
NM_003882.2-1070s21c1
DNA Barcode:
CGCCAGGTCCTATGGATTAAT

Original Target:

Taxon:
Homo sapiens (human)
Gene:
CCN4 (8840)
Gene Description:
cellular communication network factor 4
Transcript:
RefSeq NM_003882.2 (NON-CURRENT)
Match location:
Position 1070 (CDS)

Vector Information:

Vector Backbone:
pLKO_005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000373969)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this shRNA:

Sequence Information

Target Sequence:
CGCCAGGTCCTATGGATTAAT
Hairpin Sequence:
5'-CCGG-CGCCAGGTCCTATGGATTAAT-CTCGAG-ATTAATCCATAGGACCTGGCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGCCAGGTCCTATGGATTAATCTCGAGATTAATCCATAGGACCTGGCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGCCAGGTCCTATGGATTAATCTCGAGATTAATCCATAGGACCTGGCG-3'

Other clones with same target sequence:

(none)