Construct: shRNA TRCN0000380780
Construct Description:
- Construct Type:
- shRNA
- Other Identifiers:
- NM_015569.3-3096s21c1
- DNA Barcode:
- GGTAGCTCATTAAACGTAATT
Original Target:
- Taxon:
-
Homo sapiens (human)
- Gene:
- DNM3 (26052)
- Gene Description:
- dynamin 3
- Transcript:
- RefSeq NM_015569.3 (NON-CURRENT)
- Match location:
- Position 3096 (3UTR)
Vector Information:
- Vector Backbone:
- pLKO_005
- Pol II Cassette 1:
- PGK-PuroR
- Pol II Cassette 2:
- n/a
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this shRNA:
| Taxon |
Gene |
Symbol |
Description |
Transcript |
SDR Match %[?]Percent match of the "Specificity-Defining Region" of the hairpin target sequence to transcript RNA sequence. The SDR is defined as the initial 19 bases of the (21mer) target sequence.
| 84% | = 16/19 | | 89% | = 17/19 | | 95% | = 18/19 | | 100% | = 19/19 |
|
Region |
Start Pos.[?]Start position of hairpin's match to the targetted transcript sequence (1-based). |
Intrinsic Score[?]Also called "original score", this assesses the target sequence for predicted cloneability and knockdown performance. |
Adjusted Score[?]Also called "specificity score", this is a function of the intrinsic score and the specificity factor. |
| 1 |
human |
26052 |
DNM3 |
dynamin 3 |
NM_001136127.3 |
100% |
3UTR |
3067 |
13.200 |
18.480 |
| 2 |
human |
26052 |
DNM3 |
dynamin 3 |
NM_001350204.2 |
100% |
3UTR |
3097 |
13.200 |
18.480 |
| 3 |
human |
26052 |
DNM3 |
dynamin 3 |
NM_015569.5 |
100% |
3UTR |
3079 |
13.200 |
18.480 |
| 4 |
human |
26052 |
DNM3 |
dynamin 3 |
NR_146559.2 |
100% |
3UTR |
3113 |
13.200 |
18.480 |
| 5 |
human |
26052 |
DNM3 |
dynamin 3 |
XM_005245079.1 |
100% |
3UTR |
3112 |
13.200 |
18.480 |
| 6 |
human |
26052 |
DNM3 |
dynamin 3 |
XM_017000976.1 |
100% |
3UTR |
3256 |
13.200 |
18.480 |
| 7 |
human |
26052 |
DNM3 |
dynamin 3 |
XM_017000977.1 |
100% |
3UTR |
3244 |
13.200 |
18.480 |
| 8 |
human |
26052 |
DNM3 |
dynamin 3 |
XM_017000978.1 |
100% |
3UTR |
3226 |
13.200 |
18.480 |
| 9 |
human |
26052 |
DNM3 |
dynamin 3 |
XM_017000980.1 |
100% |
3UTR |
2974 |
13.200 |
18.480 |
| 10 |
human |
26052 |
DNM3 |
dynamin 3 |
XM_017000982.2 |
100% |
3UTR |
17423 |
13.200 |
18.480 |
| 11 |
human |
26052 |
DNM3 |
dynamin 3 |
XM_017000987.1 |
100% |
3UTR |
2984 |
13.200 |
18.480 |
| 12 |
human |
26052 |
DNM3 |
dynamin 3 |
XR_001737108.1 |
100% |
3UTR |
3128 |
13.200 |
18.480 |
| 13 |
human |
26052 |
DNM3 |
dynamin 3 |
XR_001737110.1 |
100% |
3UTR |
2972 |
13.200 |
18.480 |
| 14 |
human |
26052 |
DNM3 |
dynamin 3 |
XR_001737111.1 |
100% |
3UTR |
2840 |
13.200 |
18.480 |
Sequence Information
- Target Sequence:
- GGTAGCTCATTAAACGTAATT
- Hairpin Sequence:
-
5'-CCGG-GGTAGCTCATTAAACGTAATT-CTCGAG-AATTACGTTTAATGAGCTACC-TTTTTTGAAT-3'
Oligo design for arrayed cloning:
- Forward sequence:
- 5'-CCGGGGTAGCTCATTAAACGTAATTCTCGAGAATTACGTTTAATGAGCTACCTTTTTG-3'
- Reverse sequence:
- 5'-AATTCAAAAAGGTAGCTCATTAAACGTAATTCTCGAGAATTACGTTTAATGAGCTACC-3'
Other clones with same target sequence:
(none)
