Construct: shRNA TRCN0000421393

Construct Description:

Construct Type:
shRNA
Other Identifiers:
NM_009440.2-122s21c1
DNA Barcode:
AGAATGCAGTGCAATGGACTT

Original Target:

Taxon:
Mus musculus (mouse)
Gene:
Tsx (22127)
Gene Description:
testis specific X-linked gene
Transcript:
RefSeq NM_009440.2 (NON-CURRENT)
Match location:
Position 122 (CDS)

Vector Information:

Vector Backbone:
pLKO_005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Selection Marker:
PuroR
Visible Reporter:
n/a
Epitope Tag:
n/a

Current transcripts matched by this shRNA:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 mouse 22127 Tsx testis specific X-linked gene NM_009440.3 100% CDS 122 4.050 2.835
2 mouse 22127 Tsx testis specific X-linked gene XM_006527940.3 100% CDS 602 4.050 2.835
3 mouse 22127 Tsx testis specific X-linked gene XM_006527941.2 100% CDS 87 4.050 2.835
4 human 158038 LINGO2 leucine rich repeat and Ig ... NM_001258282.3 90% CDS 2461
5 human 158038 LINGO2 leucine rich repeat and Ig ... NM_001354574.2 90% CDS 2428
6 human 158038 LINGO2 leucine rich repeat and Ig ... NM_001354575.2 90% CDS 1991
7 human 158038 LINGO2 leucine rich repeat and Ig ... NM_152570.3 90% CDS 1940
8 human 158038 LINGO2 leucine rich repeat and Ig ... XM_011517724.2 90% CDS 5827
9 human 158038 LINGO2 leucine rich repeat and Ig ... XM_011517728.2 90% CDS 5606
10 human 158038 LINGO2 leucine rich repeat and Ig ... XM_017014303.2 90% CDS 6973
11 human 158038 LINGO2 leucine rich repeat and Ig ... XM_017014304.1 90% CDS 8231
12 human 158038 LINGO2 leucine rich repeat and Ig ... XM_017014305.1 90% CDS 7814
13 human 158038 LINGO2 leucine rich repeat and Ig ... XM_017014306.2 90% CDS 5081
14 human 158038 LINGO2 leucine rich repeat and Ig ... XM_017014307.1 90% CDS 2448
15 human 158038 LINGO2 leucine rich repeat and Ig ... XR_001746186.2 90% 3UTR 3843
16 human 11161 ERG28 ergosterol biosynthesis 28 ... NM_007176.4 89% 3UTR 1583
17 human 113246 C12orf57 chromosome 12 open reading ... NM_001301834.1 90% CDS 268
18 human 113246 C12orf57 chromosome 12 open reading ... NM_001301836.1 90% CDS 265
19 human 113246 C12orf57 chromosome 12 open reading ... NM_001301837.1 90% CDS 397
20 human 113246 C12orf57 chromosome 12 open reading ... NM_001301838.1 90% 5UTR 493
21 human 113246 C12orf57 chromosome 12 open reading ... NM_138425.4 90% CDS 192
22 human 113246 C12orf57 chromosome 12 open reading ... NR_126035.1 90% 3UTR 493
23 human 503542 SPRN shadow of prion protein NM_001012508.3 89% 3UTR 1059
24 mouse 71213 Cage1 cancer antigen 1 XM_011244349.2 85% 3UTR 3851
25 mouse 102643083 LOC102643083 uncharacterized LOC102643083 XR_001783423.1 89% 3UTR 3205
26 mouse 102643083 LOC102643083 uncharacterized LOC102643083 XR_001783424.1 89% 3UTR 3205
27 mouse 102643083 LOC102643083 uncharacterized LOC102643083 XR_001783425.1 89% 3UTR 3205
28 mouse 102634882 Gm32359 predicted gene, 32359 XR_379233.2 89% 3UTR 264
29 mouse 102634882 Gm32359 predicted gene, 32359 XR_379234.2 89% 3UTR 184
Download CSV

Sequence Information

Target Sequence:
AGAATGCAGTGCAATGGACTT
Hairpin Sequence:
5'-CCGG-AGAATGCAGTGCAATGGACTT-CTCGAG-AAGTCCATTGCACTGCATTCT-TTTTTTGAAT-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGAGAATGCAGTGCAATGGACTTCTCGAGAAGTCCATTGCACTGCATTCTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAAGAATGCAGTGCAATGGACTTCTCGAGAAGTCCATTGCACTGCATTCT-3'

Other clones with same target sequence:

(none)