Construct: ORF TRCN0000488161
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020543.1_s317c1
- DNA Barcode:
- TATCAGACTTTGGGGGGGCAAAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NTRK2 (4915)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488161
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001018064.3 | 100% | 100% | |
| 2 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369532.1 | 100% | 100% | |
| 3 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369533.1 | 100% | 100% | |
| 4 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | XM_011518718.3 | 100% | 100% | |
| 5 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | XM_017014752.1 | 100% | 100% | |
| 6 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | XM_017014753.2 | 100% | 100% | |
| 7 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369534.1 | 98.5% | 98.5% | 1158_1159ins36 |
| 8 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_006180.4 | 98% | 98% | 1396_1443del |
| 9 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | XM_005252001.3 | 98% | 98% | 1396_1443del |
| 10 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | XM_005252003.3 | 98% | 98% | 1396_1443del |
| 11 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | XM_005252004.2 | 98% | 98% | 1396_1443del |
| 12 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | XM_017014751.2 | 98% | 98% | 1396_1443del |
| 13 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369535.1 | 81% | 81% | 0_1ins468 |
| 14 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369536.1 | 79.4% | 79.4% | 0_1ins468;928_975del |
| 15 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001018066.3 | 64.5% | 64.2% | (many diffs) |
| 16 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369538.1 | 64.5% | 64.2% | (many diffs) |
| 17 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | XM_011518720.3 | 64.5% | 64.2% | (many diffs) |
| 18 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001018065.2 | 63.2% | 63% | (many diffs) |
| 19 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369537.1 | 63.2% | 63% | (many diffs) |
| 20 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | XM_005252006.4 | 63.2% | 63% | (many diffs) |
| 21 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | XM_017014755.1 | 63.2% | 63% | (many diffs) |
| 22 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001007097.3 | 57.2% | 56.3% | (many diffs) |
| 23 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369539.1 | 57.2% | 56.3% | (many diffs) |
| 24 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369540.1 | 57.2% | 56.3% | (many diffs) |
| 25 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369541.1 | 57.2% | 56.3% | (many diffs) |
| 26 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369542.1 | 57.2% | 56.3% | (many diffs) |
| 27 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369543.1 | 57.2% | 56.3% | (many diffs) |
| 28 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369544.1 | 57.2% | 56.3% | (many diffs) |
| 29 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369545.1 | 57.2% | 56.3% | (many diffs) |
| 30 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369548.1 | 57.2% | 56.3% | (many diffs) |
| 31 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369549.1 | 57.2% | 56.3% | (many diffs) |
| 32 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | XM_017014760.2 | 57.2% | 56.3% | (many diffs) |
| 33 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369547.1 | 56.9% | 56.5% | (many diffs) |
| 34 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001291937.1 | 55.7% | 54.6% | (many diffs) |
| 35 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369546.1 | 55.7% | 54.6% | (many diffs) |
| 36 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369550.1 | 38.3% | 37.5% | (many diffs) |
| 37 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369551.1 | 38.3% | 37.5% | (many diffs) |
| 38 | human | 4915 | NTRK2 | neurotrophic receptor tyros... | NM_001369552.1 | 38.3% | 37.5% | (many diffs) |
| 39 | mouse | 18212 | Ntrk2 | neurotrophic tyrosine kinas... | NM_001025074.2 | 87.5% | 93.9% | (many diffs) |
| 40 | mouse | 18212 | Ntrk2 | neurotrophic tyrosine kinas... | NM_001282961.1 | 87.5% | 93.9% | (many diffs) |
| 41 | mouse | 18212 | Ntrk2 | neurotrophic tyrosine kinas... | XM_006517149.3 | 87.5% | 93.9% | (many diffs) |
| 42 | mouse | 18212 | Ntrk2 | neurotrophic tyrosine kinas... | XM_017315419.1 | 87.5% | 93.9% | (many diffs) |
| 43 | mouse | 18212 | Ntrk2 | neurotrophic tyrosine kinas... | XM_006517150.3 | 56.3% | 58.3% | (many diffs) |
| 44 | mouse | 18212 | Ntrk2 | neurotrophic tyrosine kinas... | XM_006517151.3 | 51.3% | 51% | (many diffs) |
| 45 | mouse | 18212 | Ntrk2 | neurotrophic tyrosine kinas... | NM_008745.3 | 49.7% | 50.5% | (many diffs) |
| 46 | mouse | 18212 | Ntrk2 | neurotrophic tyrosine kinas... | XM_006517152.3 | 49.7% | 50.5% | (many diffs) |
| 47 | mouse | 18212 | Ntrk2 | neurotrophic tyrosine kinas... | XM_017315420.1 | 49.7% | 50.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2538
- ORF length:
- 2466
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtcgtcc tggataaggt ggcatggacc cgccatggcg cggctctggg 121 gcttctgctg gctggttgtg ggcttctgga gggccgcttt cgcctgtccc acgtcctgca 181 aatgcagtgc ctctcggatc tggtgcagcg acccttctcc tggcatcgtg gcatttccga 241 gattggagcc taacagtgta gatcctgaga acatcaccga aattttcatc gcaaaccaga 301 aaaggttaga aatcatcaac gaagatgatg ttgaagctta tgtgggactg agaaatctga 361 caattgtgga ttctggatta aaatttgtgg ctcataaagc atttctgaaa aacagcaacc 421 tgcagcacat caattttacc cgaaacaaac tgacgagttt gtctaggaaa catttccgtc 481 accttgactt gtctgaactg atcctggtgg gcaatccatt tacatgctcc tgtgacatta 541 tgtggatcaa gactctccaa gaggctaaat ccagtccaga cactcaggat ttgtactgcc 601 tgaatgaaag cagcaagaat attcccctgg caaacctgca gatacccaat tgtggtttgc 661 catctgcaaa tctggccgca cctaacctca ctgtggagga aggaaagtct atcacattat 721 cctgtagtgt ggcaggtgat ccggttccta atatgtattg ggatgttggt aacctggttt 781 ccaaacatat gaatgaaaca agccacacac agggctcctt aaggataact aacatttcat 841 ccgatgacag tgggaagcag atctcttgtg tggcggaaaa tcttgtagga gaagatcaag 901 attctgtcaa cctcactgtg cattttgcac caactatcac atttctcgaa tctccaacct 961 cagaccacca ctggtgcatt ccattcactg tgaaaggcaa ccccaaacca gcgcttcagt 1021 ggttctataa cggggcaata ttgaatgagt ccaaatacat ctgtactaaa atacatgtta 1081 ccaatcacac ggagtaccac ggctgcctcc agctggataa tcccactcac atgaacaatg 1141 gggactacac tctaatagcc aagaatgagt atgggaagga tgagaaacag atttctgctc 1201 acttcatggg ctggcctgga attgacgatg gtgcaaaccc aaattatcct gatgtaattt 1261 atgaagatta tggaactgca gcgaatgaca tcggggacac cacgaacaga agtaatgaaa 1321 tcccttccac agacgtcact gataaaaccg gtcgggaaca tctctcggtc tatgctgtgg 1381 tggtgattgc gtctgtggtg ggattttgcc ttttggtaat gctgtttctg cttaagttgg 1441 caagacactc caagtttggc atgaaaggcc cagcctccgt tatcagcaat gatgatgact 1501 ctgccagccc actccatcac atctccaatg ggagtaacac tccatcttct tcggaaggtg 1561 gcccagatgc tgtcattatt ggaatgacca agatccctgt cattgaaaat ccccagtact 1621 ttggcatcac caacagtcag ctcaagccag acacatttgt tcagcacatc aagcgacata 1681 acattgttct gaaaagggag ctaggcgaag gagcctttgg aaaagtgttc ctagctgaat 1741 gctataacct ctgtcctgag caggacaaga tcttggtggc agtgaagacc ctgaaggatg 1801 ccagtgacaa tgcacgcaag gacttccacc gtgaggccga gctcctgacc aacctccagc 1861 atgagcacat cgtcaagttc tatggcgtct gcgtggaggg cgaccccctc atcatggtct 1921 ttgagtacat gaagcatggg gacctcaaca agttcctcag ggcacacggc cctgatgccg 1981 tgctgatggc tgagggcaac ccgcccacgg aactgacgca gtcgcagatg ctgcatatag 2041 cccagcagat cgccgcgggc atggtctacc tggcgtccca gcacttcgtg caccgcgatt 2101 tggccaccag gaactgcctg gtcggggaga acttgctggt gaaaatcggg gactttggga 2161 tgtcccggga cgtgtacagc actgactact acagggtcgg tggccacaca atgctgccca 2221 ttcgctggat gccTCCAGAG AGCATCATGT ACAGGAAATT CACGACGGAA AGCGACGTCT 2281 GGAGCCTGGG GGTCGTGTTG TGGGAGATTT TCACCTATGG CAAACAGCCC TGGTACCAGC 2341 TGTCAAACAA TGAGGTGATA GAGTGTATCA CTCAGGGCCG AGTCCTGCAG CGACCCCGCA 2401 CGTGCCCCCA GGAGGTGTAT GAGCTGATGC TGGGGTGCTG GCAGCGAGAG CCCCACATGA 2461 GGAAGAACAT CAAGGGCATC CATACCCTCC TTCAGAACTT GGCCAAGGCA TCTCCGGTCT 2521 ACCTGGACAT TCTAGGCTAG GACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 2581 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 2641 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATATC AGACTTTGGG 2701 GGGGCAAAAC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt