Design Hairpins to Target a Transcript Sequence

Scoring of candidate shRNA sequences available in 2 ways:

  1. If the desired transcript is listed in NCBI RefSeq, you can find hairpin designs by:
    • Searching for an NCBI gene or transcript here or selecting "Search by Gene" from the Navigation bar above
    • Clicking on the "Transcript ID" link on the Search Results page to navigate to the "Transcript Details" page
    • Under the "Hairpin Candidate Sequences" heading, clicking the link titled "Show high scoring hairpin designs for this transcript"

    This will yield a table of the top shRNA designs for this transcript, pre-scored for predicted knockdown efficacy and for specificity vs. other genes of the same taxon.

  2. If the desired target transcript is not found in NCBI RefSeq, or is from a taxon other than mouse or human (e.g. Rat) you can paste the sequence you wish to target in the box below (in DNA or RNA form), and receive a list of matching shRNA sequence designs, scored according to predicted knockdown efficacy. Note that specificity versus other targets not is not considered in this score.

For a description of the candidate-picking process and rules, please see the following link: shRNA design process

Target transcript sequence (in DNA or RNA form):
e.g. 'ACGTATTGATGCCACAGACGTATTGATGCCACAGACGTATTGATGCCACAG', etc.