Transcript: Mouse NM_001001495.2

Mus musculus TNFAIP3 interacting protein 3 (Tnip3), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Tnip3 (414084)
Length:
3769
CDS:
211..837

Additional Resources:

NCBI RefSeq record:
NM_001001495.2
NBCI Gene record:
Tnip3 (414084)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001495.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363081 GTGAAATTAAACGCCTCAATA pLKO_005 605 CDS 100% 13.200 18.480 N Tnip3 n/a
2 TRCN0000363063 CGACCTGTAGCATTACGTTAG pLKO_005 828 CDS 100% 6.000 8.400 N Tnip3 n/a
3 TRCN0000253963 GGACCAGCAATTCCGAAATAT pLKO_005 357 CDS 100% 15.000 10.500 N Tnip3 n/a
4 TRCN0000363066 TCTGGTGCTGTGACATTATAT pLKO_005 1142 3UTR 100% 15.000 10.500 N Tnip3 n/a
5 TRCN0000253961 GAGGACTCAGGGAAGTGTAAA pLKO_005 670 CDS 100% 13.200 9.240 N Tnip3 n/a
6 TRCN0000253962 TGCAACACAAATACCACATAA pLKO_005 1268 3UTR 100% 13.200 9.240 N Tnip3 n/a
7 TRCN0000363064 CATTGGGAGCTCTTCGCTTTC pLKO_005 648 CDS 100% 6.000 4.200 N Tnip3 n/a
8 TRCN0000253964 AGAAGAAAGGACTTGACAAAT pLKO_005 268 CDS 100% 13.200 7.920 N Tnip3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001495.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.