Transcript: Human NM_001001732.3

Homo sapiens coiled-coil and C2 domain containing 2B (CC2D2B), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
CC2D2B (387707)
Length:
1854
CDS:
200..1168

Additional Resources:

NCBI RefSeq record:
NM_001001732.3
NBCI Gene record:
CC2D2B (387707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001732.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422465 CACAATTCTAATGCAACATTT pLKO_005 497 CDS 100% 13.200 9.240 N CC2D2B n/a
2 TRCN0000413281 TATTATCTGTGTGGGTCTATT pLKO_005 1122 CDS 100% 13.200 9.240 N CC2D2B n/a
3 TRCN0000417379 TTGATGTACAGTCAATTATTG pLKO_005 1011 CDS 100% 13.200 9.240 N CC2D2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001732.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.