Transcript: Human NM_001013653.2

Homo sapiens leucine rich repeat containing 26 (LRRC26), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LRRC26 (389816)
Length:
1212
CDS:
97..1101

Additional Resources:

NCBI RefSeq record:
NM_001013653.2
NBCI Gene record:
LRRC26 (389816)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001013653.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245797 AGCACTGGCACCAGGGACTTT pLKO_005 492 CDS 100% 1.650 1.155 N LRRC26 n/a
2 TRCN0000245795 ACTCAGCCTGCAGGACAACGA pLKO_005 609 CDS 100% 0.880 0.616 N LRRC26 n/a
3 TRCN0000245794 GCGCTGCGCAACCTCTCATTG pLKO_005 526 CDS 100% 0.000 0.000 N LRRC26 n/a
4 TRCN0000245796 TGTTGCTGCTGCTGTCGCCTT pLKO_005 140 CDS 100% 0.720 0.432 N LRRC26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013653.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.