Transcript: Mouse NM_001013764.2

Mus musculus carboxylesterase 1A (Ces1a), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Ces1a (244595)
Length:
1980
CDS:
85..1776

Additional Resources:

NCBI RefSeq record:
NM_001013764.2
NBCI Gene record:
Ces1a (244595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270161 CCACTACATCAGCCGACATAG pLKO_005 908 CDS 100% 10.800 15.120 N Ces1a n/a
2 TRCN0000346332 AGTGATAGTAGTCATTCAATA pLKO_005 573 CDS 100% 13.200 9.240 N Ces1a n/a
3 TRCN0000270098 CAACGACCCTGAAGATGAAAT pLKO_005 968 CDS 100% 13.200 9.240 N Ces1a n/a
4 TRCN0000270096 CCATTAGCAGCCTGGTCAATG pLKO_005 1802 3UTR 100% 10.800 7.560 N Ces1a n/a
5 TRCN0000346334 CCCTCCTATGTGCTCGCAAAT pLKO_005 333 CDS 100% 10.800 6.480 N Ces1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.