Transcript: Mouse NM_001013770.4

Mus musculus lipase, member O3 (Lipo3), mRNA.

Source:
NCBI, updated 2017-04-12
Taxon:
Mus musculus (mouse)
Gene:
Lipo3 (381236)
Length:
2854
CDS:
572..1771

Additional Resources:

NCBI RefSeq record:
NM_001013770.4
NBCI Gene record:
Lipo3 (381236)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013770.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251482 CTGAATTGAGAGAACAATAAT pLKO_005 2263 3UTR 100% 15.000 10.500 N Lipo3 n/a
2 TRCN0000265189 ACTATGGCCAGTCTCAAATAC pLKO_005 2494 3UTR 100% 13.200 9.240 N Lipo3 n/a
3 TRCN0000251483 CCTTGTAACAGAAATTGAATA pLKO_005 2367 3UTR 100% 13.200 9.240 N Lipo3 n/a
4 TRCN0000251481 TAACCCACAAGAATGATCATT pLKO_005 2312 3UTR 100% 5.625 3.938 N Lipo3 n/a
5 TRCN0000251480 TGAAGGTGATGTTCAGCTTTA pLKO_005 1750 CDS 100% 10.800 6.480 N Lipo3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013770.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.