Transcript: Mouse NM_001013804.1

Mus musculus filaggrin family member 2 (Flg2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Flg2 (229574)
Length:
7755
CDS:
84..7172

Additional Resources:

NCBI RefSeq record:
NM_001013804.1
NBCI Gene record:
Flg2 (229574)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253250 ATGACCGAAGACTAGACTTTA pLKO_005 277 CDS 100% 13.200 18.480 N Flg2 n/a
2 TRCN0000253251 TCTAGATGTTGTCAACCTAAA pLKO_005 1080 CDS 100% 10.800 15.120 N Flg2 n/a
3 TRCN0000253252 CATCTAGCTCTGGGCATAATG pLKO_005 2182 CDS 100% 13.200 9.240 N Flg2 n/a
4 TRCN0000253249 TGAGTCTGGATATAGGTTAAA pLKO_005 740 CDS 100% 13.200 9.240 N Flg2 n/a
5 TRCN0000265362 GTCATCTAGCTCTAGGCATAA pLKO_005 1592 CDS 100% 10.800 7.560 N Flg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.