Transcript: Mouse NM_001024707.2

Mus musculus low density lipoprotein receptor-related protein 3 (Lrp3), mRNA.

Source:
NCBI, updated 2017-05-22
Taxon:
Mus musculus (mouse)
Gene:
Lrp3 (435965)
Length:
4007
CDS:
418..2790

Additional Resources:

NCBI RefSeq record:
NM_001024707.2
NBCI Gene record:
Lrp3 (435965)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024707.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254602 ATGCGGACTGCTGCTTGTTAT pLKO_005 1998 CDS 100% 13.200 18.480 N Lrp3 n/a
2 TRCN0000254600 GTACGAACCTGTGCATCTTTG pLKO_005 1865 CDS 100% 10.800 15.120 N Lrp3 n/a
3 TRCN0000254604 TAGCATTCACTCTGGTGATTT pLKO_005 3541 3UTR 100% 13.200 9.240 N Lrp3 n/a
4 TRCN0000254601 TCCGCTGTGACAACGGTAAAT pLKO_005 992 CDS 100% 13.200 9.240 N Lrp3 n/a
5 TRCN0000254603 CCAACTGCAGCTGGTACATTC pLKO_005 689 CDS 100% 10.800 7.560 N Lrp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024707.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.