Transcript: Mouse NM_001033139.3

Mus musculus expressed sequence AI846148 (AI846148), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
AI846148 (68229)
Length:
3183
CDS:
226..1371

Additional Resources:

NCBI RefSeq record:
NM_001033139.3
NBCI Gene record:
AI846148 (68229)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033139.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252768 AGAATCCAGTGCCACTGTTAA pLKO_005 1320 CDS 100% 13.200 9.240 N AI846148 n/a
2 TRCN0000252767 TGTCATAGAGCAAGGGAATAA pLKO_005 843 CDS 100% 13.200 9.240 N AI846148 n/a
3 TRCN0000252769 TTGGCCACCTGATGGAGATTT pLKO_005 1469 3UTR 100% 13.200 9.240 N AI846148 n/a
4 TRCN0000252765 GACTGTAAGGACTCTTCTAAG pLKO_005 1090 CDS 100% 10.800 7.560 N AI846148 n/a
5 TRCN0000252766 GAGAATGAACCTGCTAGAAAG pLKO_005 898 CDS 100% 10.800 7.560 N AI846148 n/a
6 TRCN0000282872 GCCCACAGTTCTGTCAGAATC pLKO_005 1305 CDS 100% 10.800 7.560 N SPINDOC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033139.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.