Transcript: Mouse NM_001033259.4

Mus musculus mitochondrial calcium uniporter (Mcu), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Mcu (215999)
Length:
2872
CDS:
23..1075

Additional Resources:

NCBI RefSeq record:
NM_001033259.4
NBCI Gene record:
Mcu (215999)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033259.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265169 CATGGCCATGTATGCGTATTT pLKO_005 844 CDS 100% 13.200 18.480 N Mcu n/a
2 TRCN0000251261 GATCCGAGATGACCGTGAATC pLKO_005 1074 CDS 100% 10.800 15.120 N Mcu n/a
3 TRCN0000251263 TAGGGAATAAAGGGATCTTAA pLKO_005 1211 3UTR 100% 13.200 9.240 N Mcu n/a
4 TRCN0000251262 TCAGGCAGAAATGGATCTTAA pLKO_005 994 CDS 100% 13.200 9.240 N Mcu n/a
5 TRCN0000267404 TGATGACGTGACGGTGGTTTA pLKO_005 235 CDS 100% 10.800 7.560 N Mcu n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033259.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.