Transcript: Mouse NM_001033333.3

Mus musculus myelin regulatory factor-like (Myrfl), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Myrfl (237558)
Length:
3114
CDS:
217..2931

Additional Resources:

NCBI RefSeq record:
NM_001033333.3
NBCI Gene record:
Myrfl (237558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267030 TATCGACGTTGTAACTAATTT pLKO_005 2914 CDS 100% 15.000 21.000 N Myrfl n/a
2 TRCN0000267029 CCTCTACATACTTAGCTTAAA pLKO_005 2139 CDS 100% 13.200 10.560 N Myrfl n/a
3 TRCN0000267026 CACACCCACCAACGTCAAATT pLKO_005 2622 CDS 100% 13.200 9.240 N Myrfl n/a
4 TRCN0000267028 CTCCGACAGCGCATACCATTT pLKO_005 2808 CDS 100% 10.800 7.560 N Myrfl n/a
5 TRCN0000267027 TTTGAGGAGGACATTACCACA pLKO_005 2942 3UTR 100% 2.640 1.848 N Myrfl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.