Transcript: Mouse NM_001033427.3

Mus musculus lysozyme G-like 2 (Lyg2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Lyg2 (332427)
Length:
2564
CDS:
289..930

Additional Resources:

NCBI RefSeq record:
NM_001033427.3
NBCI Gene record:
Lyg2 (332427)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033427.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265191 TGGCTCCGTGATACGAAATTA pLKO_005 1976 3UTR 100% 15.000 21.000 N Lyg2 n/a
2 TRCN0000251389 CTTCTAGGTAGAGCGAGTTAC pLKO_005 924 CDS 100% 10.800 15.120 N Lyg2 n/a
3 TRCN0000251388 GCACTGCCAAGGGCTCATATA pLKO_005 332 CDS 100% 13.200 9.240 N Lyg2 n/a
4 TRCN0000265186 ACAGTCTGTTGGGATTCTAAC pLKO_005 729 CDS 100% 10.800 7.560 N Lyg2 n/a
5 TRCN0000251390 TGGGATCCACGGTTCGGAAAT pLKO_005 474 CDS 100% 10.800 7.560 N Lyg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033427.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.