Transcript: Mouse NM_001033438.2

Mus musculus predicted gene 906 (Gm906), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Gm906 (380882)
Length:
3152
CDS:
45..3098

Additional Resources:

NCBI RefSeq record:
NM_001033438.2
NBCI Gene record:
Gm906 (380882)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267331 AGAGCCTGTGACCCATATATG pLKO_005 2874 CDS 100% 13.200 6.600 Y Gm906 n/a
2 TRCN0000267332 TCGGAAGAACACCTTACTTAA pLKO_005 2465 CDS 100% 13.200 6.600 Y Gm906 n/a
3 TRCN0000267329 TGGGAAACATGGACCATATTC pLKO_005 728 CDS 100% 13.200 6.600 Y Gm906 n/a
4 TRCN0000267892 ACCATCACAACCTATGGAAAT pLKO_005 323 CDS 100% 10.800 5.400 Y Gm904 n/a
5 TRCN0000267330 CATTGGTAAGCATATCGATAT pLKO_005 1946 CDS 100% 10.800 5.400 Y Gm906 n/a
6 TRCN0000283559 GCAACAGCTCCATGGACATAG pLKO_005 94 CDS 100% 10.800 5.400 Y Gm904 n/a
7 TRCN0000267333 TCCTAGCTGATAAGATCAAAG pLKO_005 2269 CDS 100% 10.800 5.400 Y Gm906 n/a
8 TRCN0000267904 TGGACATGACCATTGGCTTTA pLKO_005 118 CDS 100% 10.800 5.400 Y Gm904 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.