Transcript: Mouse NM_001034871.2

Mus musculus colipase-like 2 (Clpsl2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Clpsl2 (328788)
Length:
444
CDS:
28..336

Additional Resources:

NCBI RefSeq record:
NM_001034871.2
NBCI Gene record:
Clpsl2 (328788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001034871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283441 CTGTCGATCTGGCTTGAATTG pLKO_005 270 CDS 100% 10.800 15.120 N Clpsl2 n/a
2 TRCN0000267101 CCAGTGACTGTTGCCTCATAG pLKO_005 155 CDS 100% 10.800 7.560 N Clpsl2 n/a
3 TRCN0000267103 GGAGCCTGAACATCATGTGTC pLKO_005 248 CDS 100% 4.050 2.835 N Clpsl2 n/a
4 TRCN0000267102 GAGACAAGTGTGTCCACCACA pLKO_005 125 CDS 100% 2.640 1.848 N Clpsl2 n/a
5 TRCN0000267104 TGCCACACAGACACAGTGAAA pLKO_005 80 CDS 100% 4.950 2.970 N Clpsl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001034871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.