Transcript: Human NM_001037730.1

Homo sapiens defensin beta 115 (DEFB115), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
DEFB115 (245929)
Length:
267
CDS:
1..267

Additional Resources:

NCBI RefSeq record:
NM_001037730.1
NBCI Gene record:
DEFB115 (245929)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001037730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256726 TATCACACATTCACGACCAAA pLKO_005 221 CDS 100% 4.950 6.930 N DEFB115 n/a
2 TRCN0000256725 AGAGACAAGTGAGCTATATAT pLKO_005 243 CDS 100% 15.000 10.500 N DEFB115 n/a
3 TRCN0000256727 ATGGATCAGAAGGTGCTATTA pLKO_005 99 CDS 100% 13.200 9.240 N DEFB115 n/a
4 TRCN0000256724 CATATTTGCTGTGTCCCTAAA pLKO_005 187 CDS 100% 10.800 7.560 N DEFB115 n/a
5 TRCN0000256723 GATGCAGGAAATCATGCAAAG pLKO_005 131 CDS 100% 6.000 3.600 N DEFB115 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.