Transcript: Human NM_001037735.3

Homo sapiens zinc finger protein 630 (ZNF630), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
ZNF630 (57232)
Length:
2529
CDS:
253..2226

Additional Resources:

NCBI RefSeq record:
NM_001037735.3
NBCI Gene record:
ZNF630 (57232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001037735.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239371 GTCTAATTCAGACTTACTAAA pLKO_005 810 CDS 100% 13.200 9.240 N ZNF630 n/a
2 TRCN0000239369 TGGGCATCAGAATCCATATAG pLKO_005 2181 CDS 100% 13.200 9.240 N ZNF630 n/a
3 TRCN0000239367 GCCCTATGGAGATAGTCAATG pLKO_005 951 CDS 100% 10.800 7.560 N ZNF630 n/a
4 TRCN0000239370 TCAACTGTAGAATAGACTAAT pLKO_005 2307 3UTR 100% 13.200 7.920 N ZNF630 n/a
5 TRCN0000239368 TGATTGTGGGAAGGCCTATTC pLKO_005 2224 CDS 100% 10.800 6.480 N ZNF630 n/a
6 TRCN0000234230 ACTGGAGAGAAGCCCTATAAA pLKO_005 1528 CDS 100% 15.000 7.500 Y EG666702 n/a
7 TRCN0000239754 GAGAAACCTTATGAGTGTAAT pLKO_005 1870 CDS 100% 13.200 6.600 Y Gm11677 n/a
8 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1950 CDS 100% 13.200 6.600 Y Zfp977 n/a
9 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 1696 CDS 100% 15.000 7.500 Y Gm10771 n/a
10 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 1696 CDS 100% 15.000 7.500 Y ZNF286B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037735.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.