Transcript: Human NM_001037814.1

Homo sapiens GRB2 associated binding protein family member 4 (GAB4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
GAB4 (128954)
Length:
2630
CDS:
109..1833

Additional Resources:

NCBI RefSeq record:
NM_001037814.1
NBCI Gene record:
GAB4 (128954)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001037814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245841 GAGATTCAGAAGGGCTATATG pLKO_005 448 CDS 100% 13.200 10.560 N GAB4 n/a
2 TRCN0000245842 ACAGGCTCTGAGGCGGATAAT pLKO_005 1021 CDS 100% 13.200 9.240 N GAB4 n/a
3 TRCN0000245840 AGTTGAGAAGGAAGGTTAAAG pLKO_005 2284 3UTR 100% 13.200 9.240 N GAB4 n/a
4 TRCN0000245843 GAAACAACAGGGTCATCAATG pLKO_005 1421 CDS 100% 10.800 7.560 N GAB4 n/a
5 TRCN0000245844 GAAGCAAGCAGGCGATGATTC pLKO_005 1224 CDS 100% 10.800 7.560 N GAB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.