Transcript: Human NM_001039213.4

Homo sapiens CEA cell adhesion molecule 16, tectorial membrane component (CEACAM16), mRNA.

Source:
NCBI, updated 2019-08-24
Taxon:
Homo sapiens (human)
Gene:
CEACAM16 (388551)
Length:
1696
CDS:
207..1484

Additional Resources:

NCBI RefSeq record:
NM_001039213.4
NBCI Gene record:
CEACAM16 (388551)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039213.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245738 TCAACCTGACCGTGTACTTTG pLKO_005 850 CDS 100% 10.800 7.560 N CEACAM16 n/a
2 TRCN0000245739 GTCCAGAGAGAAGAGCTCTTC pLKO_005 1503 3UTR 100% 4.050 2.835 N CEACAM16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039213.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.