Transcript: Mouse NM_001039677.2

Mus musculus solute carrier family 30 (zinc transporter), member 2 (Slc30a2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc30a2 (230810)
Length:
3313
CDS:
242..1357

Additional Resources:

NCBI RefSeq record:
NM_001039677.2
NBCI Gene record:
Slc30a2 (230810)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251767 GGTTGATTTCTGGAGATTATG pLKO_005 723 CDS 100% 13.200 18.480 N Slc30a2 n/a
2 TRCN0000265236 GGTGTTCATGATTGGCGAAAT pLKO_005 475 CDS 100% 10.800 15.120 N Slc30a2 n/a
3 TRCN0000251766 CTGTCCAGAGCAACCATTATT pLKO_005 366 CDS 100% 15.000 10.500 N Slc30a2 n/a
4 TRCN0000251765 GTGGCAGCCTATATCATATAC pLKO_005 944 CDS 100% 13.200 9.240 N Slc30a2 n/a
5 TRCN0000251764 TGTGGCTGTGAACCTCATAAT pLKO_005 784 CDS 100% 13.200 9.240 N Slc30a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.