Transcript: Mouse NM_001040696.1

Mus musculus NLR family, pyrin domain containing 1B (Nlrp1b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nlrp1b (637515)
Length:
4159
CDS:
196..3720

Additional Resources:

NCBI RefSeq record:
NM_001040696.1
NBCI Gene record:
Nlrp1b (637515)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001040696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255336 AGTTTGAACGGGAGGTCTATT pLKO_005 1052 CDS 100% 13.200 18.480 N Nlrp1b n/a
2 TRCN0000255335 TGATCTACTATCGAGTCAATC pLKO_005 3038 CDS 100% 10.800 15.120 N Nlrp1b n/a
3 TRCN0000255337 GGACCTAGGTTCCGTACATAT pLKO_005 3961 3UTR 100% 13.200 10.560 N Nlrp1b n/a
4 TRCN0000255334 TCAGCATGAGGGTCAACTAAA pLKO_005 240 CDS 100% 13.200 9.240 N Nlrp1b n/a
5 TRCN0000267560 GTGAAGGAGAGCGATGCAATT pLKO_005 1087 CDS 100% 10.800 7.560 N Nlrp1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.