Transcript: Mouse NM_001044382.2

Mus musculus prokineticin 1 (Prok1), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-09-30
Taxon:
Mus musculus (mouse)
Gene:
Prok1 (246691)
Length:
4044
CDS:
59..376

Additional Resources:

NCBI RefSeq record:
NM_001044382.2
NBCI Gene record:
Prok1 (246691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001044382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254139 GTGAACGAGATATCCAGTGTG pLKO_005 135 CDS 100% 4.050 3.240 N Prok1 n/a
2 TRCN0000254137 TCATGCTCCTTCTAGCAACGG pLKO_005 84 CDS 100% 2.160 1.728 N Prok1 n/a
3 TRCN0000377207 TCCGACTGTGCGGTCATCACA pLKO_005 107 CDS 100% 1.000 0.800 N Prok1 n/a
4 TRCN0000367354 CACCCAGGAAGCCACAAGATC pLKO_005 239 CDS 100% 1.650 1.155 N Prok1 n/a
5 TRCN0000254138 CACCTGCTGCGCTATCAGTCT pLKO_005 163 CDS 100% 0.880 0.616 N Prok1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001044382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.