Transcript: Human NM_001079559.3

Homo sapiens heterogeneous nuclear ribonucleoprotein U like 2 (HNRNPUL2), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
HNRNPUL2 (221092)
Length:
5214
CDS:
302..2545

Additional Resources:

NCBI RefSeq record:
NM_001079559.3
NBCI Gene record:
HNRNPUL2 (221092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001079559.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230598 CTTAGGGCTGCCTGTTCTATA pLKO_005 2841 3UTR 100% 13.200 9.240 N HNRNPUL2 n/a
2 TRCN0000218928 TATTGGCTGCTTTGCTAATTT pLKO_005 1381 CDS 100% 15.000 7.500 Y HNRNPUL2 n/a
3 TRCN0000230597 CCCGGACAAAGAGGAACTTTA pLKO_005 1881 CDS 100% 13.200 6.600 Y HNRNPUL2 n/a
4 TRCN0000217947 TGAGACTGTGCTCAATCAAAT pLKO_005 1759 CDS 100% 13.200 6.600 Y HNRNPUL2 n/a
5 TRCN0000230596 TTGTGAACCTGGACACGTATA pLKO_005 1035 CDS 100% 10.800 5.400 Y HNRNPUL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001079559.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.