Transcript: Human NM_001080442.2

Homo sapiens solute carrier family 38 member 8 (SLC38A8), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
SLC38A8 (146167)
Length:
1425
CDS:
1..1308

Additional Resources:

NCBI RefSeq record:
NM_001080442.2
NBCI Gene record:
SLC38A8 (146167)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245911 TCTACTGCAGCATGCGCAAAC pLKO_005 713 CDS 100% 6.000 8.400 N SLC38A8 n/a
2 TRCN0000245912 GTCCTACCCAGGCAATGATAT pLKO_005 858 CDS 100% 13.200 9.240 N SLC38A8 n/a
3 TRCN0000245909 TTTGCTGTCTCCATCGTAACT pLKO_005 904 CDS 100% 4.950 3.465 N SLC38A8 n/a
4 TRCN0000245910 TATGCCTGACCTCAGCGAGAT pLKO_005 1092 CDS 100% 4.050 2.835 N SLC38A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.